Mutagenetix > Incidental Mutations

Incidental Mutation 'R7128:Gpr161'

552432

Institutional Source

Beutler Lab

Gene Symbol

Gpr161

Ensembl Gene

ENSMUSG00000040836

Gene Name

G protein-coupled receptor 161

Synonyms

LOC240888, vl

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7128 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

165295789-165326745 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 165310457 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 204 (Y204F)

Ref Sequence

ENSEMBL: ENSMUSP00000136621 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111450] [ENSMUST00000178700]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111450
AA Change: Y187F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107077
Gene: ENSMUSG00000040836
AA Change: Y187F

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	48	261	1.1e-6	PFAM
Pfam:7tm_1	57	337	3e-47	PFAM
low complexity region	476	489	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178700
AA Change: Y204F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000136621
Gene: ENSMUSG00000040836
AA Change: Y204F

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	63	273	1.5e-7	PFAM
Pfam:7tm_1	72	352	9.2e-48	PFAM
low complexity region	491	504	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Upon ligand binding, G protein-coupled receptors, such as GPR161, activate cytoplasmic G proteins (see GNAS, MIM 139320), allowing the receptors to transduce extracellular signals across the plasma membrane into the cell. Phosphorylation of the receptor attenuates signaling (Matteson et al., 2008 [PubMed 18250320]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a null mutation display complete embryonic lethality during organogenesis, extensive craniofacial abnormalities, ventralization of the neural tube with expansion of the floor plate, absence of limb development, and caudal spina bifida. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,716,481	T1871A	possibly damaging	Het
Adgb	T	C	10: 10,472,241	D25G	probably benign	Het
Ak9	T	C	10: 41,424,717	V1641A	unknown	Het
Akap2	T	C	4: 57,855,816	S382P	probably benign	Het
Akirin2	T	C	4: 34,562,435	I118T	probably benign	Het
Aldh1l1	G	T	6: 90,563,379	Q215H	probably benign	Het
Arhgef26	T	C	3: 62,419,550	F495L	possibly damaging	Het
Atg4a-ps	T	A	3: 103,645,747	R93*	probably null	Het
AW822073	T	C	10: 58,223,657	Q425R	unknown	Het
Catsper3	A	G	13: 55,798,849	I120V	probably benign	Het
Cavin2	A	G	1: 51,289,420	Q12R	possibly damaging	Het
Cenpf	A	T	1: 189,684,991	F39Y	probably damaging	Het
Chfr	T	C	5: 110,143,636	Y107H	probably benign	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Defb4	T	A	8: 19,201,204	I29K	possibly damaging	Het
Dnah7c	A	G	1: 46,527,485	T619A	probably benign	Het
Emc3	A	G	6: 113,517,920	L179P	probably damaging	Het
Eno3	G	C	11: 70,658,604	V84L	possibly damaging	Het
Fam110a	C	T	2: 151,970,722	V43M	probably damaging	Het
Fam159a	G	T	4: 108,367,903	T154K	probably benign	Het
Fbxo30	T	A	10: 11,290,116	L194*	probably null	Het
Galnt14	T	C	17: 73,545,101	T108A	probably benign	Het
Glipr2	T	C	4: 43,968,601	I51T	probably benign	Het
Gm1527	C	T	3: 28,915,311	S270F	possibly damaging	Het
Gm3336	A	G	8: 70,718,554	M1V	probably null	Het
Gm4744	T	C	6: 40,950,376	D15G		Het
Gm4763	C	T	7: 24,725,999		probably null	Het
Gm4924	G	A	10: 82,378,699	C777Y	unknown	Het
Gm5901	G	A	7: 105,378,201	G306S	probably damaging	Het
Gon4l	T	A	3: 88,895,692	N1203K	possibly damaging	Het
Igsf10	T	C	3: 59,328,905	E1285G	probably benign	Het
Irx6	T	C	8: 92,677,366	L187P	probably damaging	Het
Itgb1bp1	A	G	12: 21,272,088	Y117H	probably benign	Het
Itln1	C	A	1: 171,530,575	D202Y	possibly damaging	Het
Kctd9	T	C	14: 67,738,523	S242P	probably benign	Het
Lrrk2	A	G	15: 91,801,885	H2143R	probably benign	Het
Lynx1	G	A	15: 74,751,549	R50*	probably null	Het
Map10	A	G	8: 125,671,853	I662V	probably benign	Het
Mlxipl	T	C	5: 135,133,851	L691P	probably damaging	Het
Muc16	A	G	9: 18,643,004	S3998P	unknown	Het
Nalcn	A	T	14: 123,594,502	V120E	probably damaging	Het
Nfat5	T	C	8: 107,358,691	S539P	probably benign	Het
Olfml3	T	C	3: 103,737,168	M62V	probably benign	Het
Orm3	T	C	4: 63,357,825	V158A	probably benign	Het
Pced1b	A	T	15: 97,384,598	K173*	probably null	Het
Pdzd7	T	C	19: 45,027,949	D911G	probably damaging	Het
Pkn3	A	G	2: 30,083,315	D383G	probably damaging	Het
Pm20d1	A	G	1: 131,797,554	E46G	probably benign	Het
Pyroxd2	A	T	19: 42,731,403	S455T	probably benign	Het
Rmnd5b	T	A	11: 51,624,537	I301F	possibly damaging	Het
Rnf225	A	G	7: 12,927,984	N30S	probably benign	Het
Slfn3	T	A	11: 83,214,895	C573S	probably benign	Het
Smc6	A	G	12: 11,301,631	E887G	probably damaging	Het
Sp140	A	T	1: 85,620,125	D191V	possibly damaging	Het
Srf	C	T	17: 46,555,446	S128N	possibly damaging	Het
Sult6b1	T	C	17: 78,894,641	D144G	probably damaging	Het
Syne1	G	A	10: 5,243,180	A3956V	probably damaging	Het
Syt10	A	T	15: 89,814,111	D343E	probably damaging	Het
Tgtp2	G	A	11: 49,059,308	R146C	possibly damaging	Het
Tmcc3	A	T	10: 94,430,634		probably benign	Het
Tnfrsf1a	A	T	6: 125,361,536	T337S	probably benign	Het
Tns1	A	T	1: 73,995,304	I144N		Het
Trim11	A	G	11: 58,978,277	E13G	probably damaging	Het
Trpm6	A	T	19: 18,811,773	H569L	possibly damaging	Het
Ttbk2	T	A	2: 120,746,088	I803L	probably benign	Het
Vmn1r21	G	T	6: 57,843,951	N169K	probably damaging	Het
Vmn2r60	C	T	7: 42,195,112	T633I	probably damaging	Het
Wt1	T	C	2: 105,127,325	Y177H	probably benign	Het

Other mutations in Gpr161

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Gpr161	APN	1	165318803	missense	probably benign
IGL01090:Gpr161	APN	1	165306580	missense	probably damaging	1.00
IGL01151:Gpr161	APN	1	165321509	missense	probably damaging	1.00
IGL01763:Gpr161	APN	1	165317251	missense	probably benign	0.09
IGL03206:Gpr161	APN	1	165321649	missense	probably damaging	1.00
IGL03279:Gpr161	APN	1	165310529	missense	probably damaging	1.00
IGL03378:Gpr161	APN	1	165310508	missense	probably damaging	0.99
IGL03147:Gpr161	UTSW	1	165317308	missense	probably benign	0.30
R0367:Gpr161	UTSW	1	165317236	splice site	probably benign
R1827:Gpr161	UTSW	1	165306567	missense	possibly damaging	0.94
R1970:Gpr161	UTSW	1	165306358	missense	probably damaging	0.97
R1991:Gpr161	UTSW	1	165306563	missense	probably damaging	0.98
R2425:Gpr161	UTSW	1	165310623	missense	possibly damaging	0.83
R4805:Gpr161	UTSW	1	165306460	missense	probably damaging	1.00
R5416:Gpr161	UTSW	1	165321461	missense	probably benign	0.00
R5546:Gpr161	UTSW	1	165306413	missense	possibly damaging	0.88
R5547:Gpr161	UTSW	1	165306413	missense	possibly damaging	0.88
R5824:Gpr161	UTSW	1	165310991	missense	possibly damaging	0.94
R6152:Gpr161	UTSW	1	165310295	missense	possibly damaging	0.58
R6658:Gpr161	UTSW	1	165306567	missense	possibly damaging	0.50
R6924:Gpr161	UTSW	1	165321619	missense	possibly damaging	0.83
R7216:Gpr161	UTSW	1	165306546	missense	probably benign	0.22
R7540:Gpr161	UTSW	1	165318835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTCCTGTATCCAATGGTGTAC -3'
(R):5'- ATAGACCACTCCTTGAAGGGC -3'

Sequencing Primer
(F):5'- GTATCCAATGGTGTACCCCATGAAG -3'
(R):5'- ACTCCTTGAAGGGCATTCC -3'

Posted On

2019-05-15