Incidental Mutation 'R7128:Wt1'
ID 552436
Institutional Source Beutler Lab
Gene Symbol Wt1
Ensembl Gene ENSMUSG00000016458
Gene Name Wilms tumor 1 homolog
Synonyms Wt-1, D630046I19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 105126529-105173616 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105127325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 177 (Y177H)
Ref Sequence ENSEMBL: ENSMUSP00000117891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111098] [ENSMUST00000111099] [ENSMUST00000133470] [ENSMUST00000143043] [ENSMUST00000146842] [ENSMUST00000213301]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000111098
SMART Domains Protein: ENSMUSP00000106727
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 160 5e-93 PFAM
ZnF_C2H2 162 186 1.33e-1 SMART
ZnF_C2H2 192 216 2.12e-4 SMART
ZnF_C2H2 222 244 1.92e-2 SMART
ZnF_C2H2 253 277 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111099
SMART Domains Protein: ENSMUSP00000106728
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 119 6.2e-63 PFAM
Pfam:WT1 113 177 4.6e-27 PFAM
ZnF_C2H2 179 203 1.33e-1 SMART
ZnF_C2H2 209 233 2.12e-4 SMART
ZnF_C2H2 239 261 1.92e-2 SMART
ZnF_C2H2 267 291 1.89e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133470
AA Change: Y109H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120054
Gene: ENSMUSG00000016458
AA Change: Y109H

DomainStartEndE-ValueType
Pfam:WT1 1 304 3.2e-165 PFAM
ZnF_C2H2 306 330 1.33e-1 SMART
ZnF_C2H2 336 360 2.12e-4 SMART
ZnF_C2H2 366 388 1.92e-2 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123592
Gene: ENSMUSG00000016458
AA Change: Y39H

DomainStartEndE-ValueType
Pfam:WT1 1 235 9.8e-135 PFAM
ZnF_C2H2 237 261 1.33e-1 SMART
ZnF_C2H2 267 291 2.12e-4 SMART
ZnF_C2H2 297 319 1.92e-2 SMART
ZnF_C2H2 325 349 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143043
AA Change: Y177H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117891
Gene: ENSMUSG00000016458
AA Change: Y177H

DomainStartEndE-ValueType
Pfam:WT1 69 389 1e-149 PFAM
ZnF_C2H2 391 415 1.33e-1 SMART
ZnF_C2H2 421 445 2.12e-4 SMART
ZnF_C2H2 451 473 1.92e-2 SMART
ZnF_C2H2 482 506 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146842
AA Change: Y109H

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120702
Gene: ENSMUSG00000016458
AA Change: Y109H

DomainStartEndE-ValueType
Pfam:WT1 1 225 5.1e-117 PFAM
Pfam:WT1 222 278 2.1e-26 PFAM
ZnF_C2H2 280 304 1.33e-1 SMART
ZnF_C2H2 310 334 2.12e-4 SMART
ZnF_C2H2 340 362 1.92e-2 SMART
ZnF_C2H2 371 395 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213301
AA Change: Y177H

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It plays an essential role in the normal development of the urogenital system, and the orthologous human gene is mutated in a small subset of patients with Wilm's tumors. Alternative splicing has been noted for this gene, however, the full-length nature of these variants is not known. The mRNA for this gene has been shown to initiate translation from non-AUG (CUG) and AUG translation start sites, resulting in different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutants fail to develop normal kidneys or gonads, and on some genetic backgrounds, a spleen. Mutants have abnormalities of the heart, mesothelium and lungs and die between embryonic day 13.5 and birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Other mutations in Wt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Wt1 APN 2 105144141 critical splice acceptor site probably null
IGL00846:Wt1 APN 2 105166957 missense probably damaging 1.00
IGL01411:Wt1 APN 2 105132974 missense probably damaging 1.00
IGL02936:Wt1 APN 2 105169039 missense probably damaging 1.00
IGL03063:Wt1 APN 2 105170023 splice site probably null
R0127:Wt1 UTSW 2 105133457 missense probably damaging 1.00
R1462:Wt1 UTSW 2 105166831 missense probably damaging 1.00
R1462:Wt1 UTSW 2 105166831 missense probably damaging 1.00
R2061:Wt1 UTSW 2 105131157 splice site probably null
R2284:Wt1 UTSW 2 105172321 missense probably benign 0.43
R2358:Wt1 UTSW 2 105163428 splice site probably benign
R3711:Wt1 UTSW 2 105163428 splice site probably benign
R5096:Wt1 UTSW 2 105143125 missense probably damaging 1.00
R5590:Wt1 UTSW 2 105127284 missense probably damaging 1.00
R5984:Wt1 UTSW 2 105172252 missense probably benign 0.44
R6821:Wt1 UTSW 2 105172267 missense probably damaging 1.00
R7698:Wt1 UTSW 2 105126816 missense probably benign 0.33
R7913:Wt1 UTSW 2 105166860 missense probably damaging 0.98
R8005:Wt1 UTSW 2 105127444 critical splice donor site probably null
R8944:Wt1 UTSW 2 105127239 missense possibly damaging 0.92
R9032:Wt1 UTSW 2 105126815 missense probably benign 0.18
Z1176:Wt1 UTSW 2 105127107 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCCAGCGCCGAGAATC -3'
(R):5'- GCTGCTGAGTAAGAACTGGC -3'

Sequencing Primer
(F):5'- TCATGGGTTCCGACGTGC -3'
(R):5'- CTGCTGAGTAAGAACTGGCATCAG -3'
Posted On 2019-05-15