Incidental Mutation 'R7128:Arhgef26'
ID 552441
Institutional Source Beutler Lab
Gene Symbol Arhgef26
Ensembl Gene ENSMUSG00000036885
Gene Name Rho guanine nucleotide exchange factor (GEF) 26
Synonyms 4631416L12Rik, 8430436L14Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R7128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 62338344-62462221 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62419550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 495 (F495L)
Ref Sequence ENSEMBL: ENSMUSP00000078281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079300]
AlphaFold D3YYY8
Predicted Effect possibly damaging
Transcript: ENSMUST00000079300
AA Change: F495L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078281
Gene: ENSMUSG00000036885
AA Change: F495L

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
RhoGEF 441 620 1e-45 SMART
PH 654 782 4.04e-9 SMART
SH3 790 847 3.82e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161057
SMART Domains Protein: ENSMUSP00000124392
Gene: ENSMUSG00000036885

DomainStartEndE-ValueType
Pfam:RhoGEF 2 87 2.3e-19 PFAM
PH 121 249 4.04e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective activation of RhoG and reduced membrane protrusion after ICAM-1 clustering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in Arhgef26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Arhgef26 APN 3 62340383 missense probably benign
IGL01060:Arhgef26 APN 3 62340121 missense probably benign 0.44
IGL01942:Arhgef26 APN 3 62340094 missense probably benign 0.03
IGL02085:Arhgef26 APN 3 62459724 intron probably benign
IGL02172:Arhgef26 APN 3 62459676 missense probably benign 0.03
IGL03017:Arhgef26 APN 3 62448281 missense possibly damaging 0.46
IGL03101:Arhgef26 APN 3 62419661 missense possibly damaging 0.95
IGL03296:Arhgef26 APN 3 62423505 missense probably damaging 1.00
IGL03401:Arhgef26 APN 3 62423532 missense possibly damaging 0.95
R0138:Arhgef26 UTSW 3 62448259 missense probably benign 0.06
R0140:Arhgef26 UTSW 3 62448245 missense probably benign 0.02
R0152:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0157:Arhgef26 UTSW 3 62380971 missense probably damaging 1.00
R0308:Arhgef26 UTSW 3 62340399 missense probably benign 0.01
R0317:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0529:Arhgef26 UTSW 3 62339725 missense probably benign
R0825:Arhgef26 UTSW 3 62426593 missense probably damaging 0.97
R1331:Arhgef26 UTSW 3 62340028 missense probably benign 0.00
R1333:Arhgef26 UTSW 3 62340323 missense probably benign 0.04
R1351:Arhgef26 UTSW 3 62380841 missense probably damaging 1.00
R1740:Arhgef26 UTSW 3 62423583 missense probably damaging 1.00
R2121:Arhgef26 UTSW 3 62340283 missense probably damaging 0.96
R2404:Arhgef26 UTSW 3 62428915 missense possibly damaging 0.90
R2437:Arhgef26 UTSW 3 62432581 missense probably damaging 0.96
R2939:Arhgef26 UTSW 3 62380910 missense possibly damaging 0.72
R3084:Arhgef26 UTSW 3 62377616 missense probably benign 0.19
R3712:Arhgef26 UTSW 3 62423629 missense probably damaging 1.00
R4005:Arhgef26 UTSW 3 62340395 missense probably benign
R4225:Arhgef26 UTSW 3 62380922 missense probably benign 0.00
R4635:Arhgef26 UTSW 3 62340440 missense probably damaging 1.00
R4961:Arhgef26 UTSW 3 62459625 missense probably damaging 1.00
R4989:Arhgef26 UTSW 3 62340385 missense possibly damaging 0.94
R5249:Arhgef26 UTSW 3 62340560 missense probably damaging 1.00
R5284:Arhgef26 UTSW 3 62419631 missense probably damaging 0.99
R5661:Arhgef26 UTSW 3 62377654 splice site probably benign
R5970:Arhgef26 UTSW 3 62340047 missense probably benign
R6022:Arhgef26 UTSW 3 62428939 missense probably damaging 1.00
R6193:Arhgef26 UTSW 3 62339792 missense possibly damaging 0.49
R6247:Arhgef26 UTSW 3 62380960 missense probably damaging 1.00
R6434:Arhgef26 UTSW 3 62428914 missense probably damaging 0.99
R6827:Arhgef26 UTSW 3 62423498 splice site probably null
R7111:Arhgef26 UTSW 3 62345268 missense possibly damaging 0.90
R7360:Arhgef26 UTSW 3 62448205 missense possibly damaging 0.63
R7456:Arhgef26 UTSW 3 62340055 missense probably benign 0.00
R8039:Arhgef26 UTSW 3 62339930 missense probably benign 0.32
R8120:Arhgef26 UTSW 3 62341375 missense probably damaging 1.00
R8511:Arhgef26 UTSW 3 62428929 missense probably damaging 0.98
R8887:Arhgef26 UTSW 3 62339980 missense probably benign 0.04
R8979:Arhgef26 UTSW 3 62339548 missense possibly damaging 0.78
R8993:Arhgef26 UTSW 3 62448104 missense probably benign 0.43
R9213:Arhgef26 UTSW 3 62432579 missense probably benign 0.03
R9269:Arhgef26 UTSW 3 62340499 missense probably damaging 0.98
R9712:Arhgef26 UTSW 3 62423613 missense probably damaging 1.00
R9776:Arhgef26 UTSW 3 62339382 start gained probably benign
Z1177:Arhgef26 UTSW 3 62339930 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AATATCCCGGATCCACTTAAGATC -3'
(R):5'- AGAGCATTTGACACTACTTACAGC -3'

Sequencing Primer
(F):5'- AGATCAACACTTAAAGCAGTAATGG -3'
(R):5'- TGACACTACTTACAGCAACTTCTG -3'
Posted On 2019-05-15