Mutagenetix > Incidental Mutations

Incidental Mutation 'R7128:Gon4l'

552442

Institutional Source

Beutler Lab

Gene Symbol

Gon4l

Ensembl Gene

ENSMUSG00000054199

Gene Name

gon-4-like (C.elegans)

Synonyms

2610100B20Rik, 1500041I23Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.748) question?

Stock #

R7128 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88835231-88910103 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88895692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1203 (N1203K)

Ref Sequence

ENSEMBL: ENSMUSP00000103122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081695
AA Change: N1203K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: N1203K

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090942
AA Change: N1204K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: N1204K

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	241	257	N/A	INTRINSIC
low complexity region	349	378	N/A	INTRINSIC
low complexity region	433	440	N/A	INTRINSIC
low complexity region	528	543	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
Blast:SANT	814	866	2e-23	BLAST
low complexity region	962	976	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1419	1435	N/A	INTRINSIC
low complexity region	1453	1498	N/A	INTRINSIC
low complexity region	1508	1542	N/A	INTRINSIC
Pfam:PAH	1654	1700	2.1e-8	PFAM
low complexity region	1801	1812	N/A	INTRINSIC
coiled coil region	1920	1944	N/A	INTRINSIC
low complexity region	2086	2095	N/A	INTRINSIC
SANT	2154	2205	2.2e-1	SMART
low complexity region	2208	2223	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107498
AA Change: N1203K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: N1203K

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212694

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,716,481	T1871A	possibly damaging	Het
Adgb	T	C	10: 10,472,241	D25G	probably benign	Het
Ak9	T	C	10: 41,424,717	V1641A	unknown	Het
Akap2	T	C	4: 57,855,816	S382P	probably benign	Het
Akirin2	T	C	4: 34,562,435	I118T	probably benign	Het
Aldh1l1	G	T	6: 90,563,379	Q215H	probably benign	Het
Arhgef26	T	C	3: 62,419,550	F495L	possibly damaging	Het
Atg4a-ps	T	A	3: 103,645,747	R93*	probably null	Het
AW822073	T	C	10: 58,223,657	Q425R	unknown	Het
Catsper3	A	G	13: 55,798,849	I120V	probably benign	Het
Cavin2	A	G	1: 51,289,420	Q12R	possibly damaging	Het
Cenpf	A	T	1: 189,684,991	F39Y	probably damaging	Het
Chfr	T	C	5: 110,143,636	Y107H	probably benign	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Defb4	T	A	8: 19,201,204	I29K	possibly damaging	Het
Dnah7c	A	G	1: 46,527,485	T619A	probably benign	Het
Emc3	A	G	6: 113,517,920	L179P	probably damaging	Het
Eno3	G	C	11: 70,658,604	V84L	possibly damaging	Het
Fam110a	C	T	2: 151,970,722	V43M	probably damaging	Het
Fam159a	G	T	4: 108,367,903	T154K	probably benign	Het
Fbxo30	T	A	10: 11,290,116	L194*	probably null	Het
Galnt14	T	C	17: 73,545,101	T108A	probably benign	Het
Glipr2	T	C	4: 43,968,601	I51T	probably benign	Het
Gm1527	C	T	3: 28,915,311	S270F	possibly damaging	Het
Gm3336	A	G	8: 70,718,554	M1V	probably null	Het
Gm4744	T	C	6: 40,950,376	D15G		Het
Gm4763	C	T	7: 24,725,999		probably null	Het
Gm4924	G	A	10: 82,378,699	C777Y	unknown	Het
Gm5901	G	A	7: 105,378,201	G306S	probably damaging	Het
Gpr161	A	T	1: 165,310,457	Y204F	possibly damaging	Het
Igsf10	T	C	3: 59,328,905	E1285G	probably benign	Het
Irx6	T	C	8: 92,677,366	L187P	probably damaging	Het
Itgb1bp1	A	G	12: 21,272,088	Y117H	probably benign	Het
Itln1	C	A	1: 171,530,575	D202Y	possibly damaging	Het
Kctd9	T	C	14: 67,738,523	S242P	probably benign	Het
Lrrk2	A	G	15: 91,801,885	H2143R	probably benign	Het
Lynx1	G	A	15: 74,751,549	R50*	probably null	Het
Map10	A	G	8: 125,671,853	I662V	probably benign	Het
Mlxipl	T	C	5: 135,133,851	L691P	probably damaging	Het
Muc16	A	G	9: 18,643,004	S3998P	unknown	Het
Nalcn	A	T	14: 123,594,502	V120E	probably damaging	Het
Nfat5	T	C	8: 107,358,691	S539P	probably benign	Het
Olfml3	T	C	3: 103,737,168	M62V	probably benign	Het
Orm3	T	C	4: 63,357,825	V158A	probably benign	Het
Pced1b	A	T	15: 97,384,598	K173*	probably null	Het
Pdzd7	T	C	19: 45,027,949	D911G	probably damaging	Het
Pkn3	A	G	2: 30,083,315	D383G	probably damaging	Het
Pm20d1	A	G	1: 131,797,554	E46G	probably benign	Het
Pyroxd2	A	T	19: 42,731,403	S455T	probably benign	Het
Rmnd5b	T	A	11: 51,624,537	I301F	possibly damaging	Het
Rnf225	A	G	7: 12,927,984	N30S	probably benign	Het
Slfn3	T	A	11: 83,214,895	C573S	probably benign	Het
Smc6	A	G	12: 11,301,631	E887G	probably damaging	Het
Sp140	A	T	1: 85,620,125	D191V	possibly damaging	Het
Srf	C	T	17: 46,555,446	S128N	possibly damaging	Het
Sult6b1	T	C	17: 78,894,641	D144G	probably damaging	Het
Syne1	G	A	10: 5,243,180	A3956V	probably damaging	Het
Syt10	A	T	15: 89,814,111	D343E	probably damaging	Het
Tgtp2	G	A	11: 49,059,308	R146C	possibly damaging	Het
Tmcc3	A	T	10: 94,430,634		probably benign	Het
Tnfrsf1a	A	T	6: 125,361,536	T337S	probably benign	Het
Tns1	A	T	1: 73,995,304	I144N		Het
Trim11	A	G	11: 58,978,277	E13G	probably damaging	Het
Trpm6	A	T	19: 18,811,773	H569L	possibly damaging	Het
Ttbk2	T	A	2: 120,746,088	I803L	probably benign	Het
Vmn1r21	G	T	6: 57,843,951	N169K	probably damaging	Het
Vmn2r60	C	T	7: 42,195,112	T633I	probably damaging	Het
Wt1	T	C	2: 105,127,325	Y177H	probably benign	Het

Other mutations in Gon4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00870:Gon4l	APN	3	88857185	missense	probably damaging	1.00
IGL02002:Gon4l	APN	3	88895336	missense	possibly damaging	0.46
IGL02065:Gon4l	APN	3	88857210	missense	probably null	1.00
IGL02283:Gon4l	APN	3	88895364	missense	probably damaging	0.99
IGL02669:Gon4l	APN	3	88895499	missense	probably damaging	1.00
IGL03222:Gon4l	APN	3	88895643	missense	possibly damaging	0.56
IGL03385:Gon4l	APN	3	88907543	missense	probably benign	0.10
PIT4581001:Gon4l	UTSW	3	88895514	missense	probably damaging	1.00
R0020:Gon4l	UTSW	3	88858937	missense	probably damaging	1.00
R0115:Gon4l	UTSW	3	88895682	missense	probably damaging	1.00
R0173:Gon4l	UTSW	3	88858403	missense	probably damaging	1.00
R0270:Gon4l	UTSW	3	88858400	missense	probably damaging	1.00
R0961:Gon4l	UTSW	3	88898096	splice site	probably benign
R1017:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R1163:Gon4l	UTSW	3	88892535	missense	probably damaging	1.00
R1729:Gon4l	UTSW	3	88903098	missense	probably damaging	1.00
R1764:Gon4l	UTSW	3	88892599	missense	probably damaging	1.00
R1861:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R2141:Gon4l	UTSW	3	88887595	missense	possibly damaging	0.66
R2347:Gon4l	UTSW	3	88863517	missense	probably damaging	1.00
R2402:Gon4l	UTSW	3	88859043	missense	probably damaging	1.00
R2842:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R4375:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4376:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4377:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4569:Gon4l	UTSW	3	88910090	intron	probably benign
R4650:Gon4l	UTSW	3	88863552	missense	possibly damaging	0.94
R4859:Gon4l	UTSW	3	88895348	missense	probably benign	0.00
R4901:Gon4l	UTSW	3	88908151	missense	possibly damaging	0.50
R4998:Gon4l	UTSW	3	88899998	missense	probably damaging	1.00
R5059:Gon4l	UTSW	3	88900012	missense	probably benign	0.00
R5217:Gon4l	UTSW	3	88887575	missense	probably damaging	1.00
R5269:Gon4l	UTSW	3	88895528	missense	probably benign
R5279:Gon4l	UTSW	3	88887637	missense	probably benign
R5283:Gon4l	UTSW	3	88887590	missense	probably damaging	1.00
R5386:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R5433:Gon4l	UTSW	3	88896225	missense	possibly damaging	0.93
R5583:Gon4l	UTSW	3	88899971	missense	probably damaging	1.00
R5695:Gon4l	UTSW	3	88896216	frame shift	probably null
R5921:Gon4l	UTSW	3	88909947	intron	probably benign
R6003:Gon4l	UTSW	3	88896093	missense	probably damaging	0.99
R6063:Gon4l	UTSW	3	88899999	missense	probably damaging	1.00
R6217:Gon4l	UTSW	3	88892661	missense	possibly damaging	0.62
R6273:Gon4l	UTSW	3	88855849	missense	probably damaging	1.00
R6280:Gon4l	UTSW	3	88890888	missense	probably damaging	1.00
R6790:Gon4l	UTSW	3	88858998	missense	probably damaging	1.00
R6829:Gon4l	UTSW	3	88880106	missense	possibly damaging	0.96
R6891:Gon4l	UTSW	3	88858866	splice site	probably null
R7315:Gon4l	UTSW	3	88895179	missense	probably benign	0.00
R7355:Gon4l	UTSW	3	88863520	missense	probably damaging	1.00
R7426:Gon4l	UTSW	3	88907522	missense	probably benign
R7635:Gon4l	UTSW	3	88895106	missense	probably benign	0.03
R7643:Gon4l	UTSW	3	88902807	missense	probably damaging	1.00
R7715:Gon4l	UTSW	3	88908006	missense	probably benign
R7773:Gon4l	UTSW	3	88895795	missense	probably benign	0.00
R8090:Gon4l	UTSW	3	88892624	missense	probably damaging	1.00
R8224:Gon4l	UTSW	3	88895142	missense	probably damaging	1.00
R8260:Gon4l	UTSW	3	88892630	missense	probably damaging	0.98
R8434:Gon4l	UTSW	3	88854779	missense	probably damaging	1.00
R8732:Gon4l	UTSW	3	88899984	missense	possibly damaging	0.95
R8812:Gon4l	UTSW	3	88895007	missense	possibly damaging	0.86
R9132:Gon4l	UTSW	3	88908177	missense	probably benign	0.29
R9161:Gon4l	UTSW	3	88901648	missense	probably damaging	1.00
R9187:Gon4l	UTSW	3	88879311	missense	probably benign	0.10
R9212:Gon4l	UTSW	3	88896423	missense	probably benign	0.01
R9338:Gon4l	UTSW	3	88901712	missense	probably benign	0.00
R9387:Gon4l	UTSW	3	88894953	missense	probably benign	0.00
R9416:Gon4l	UTSW	3	88896231	missense	probably benign	0.00
Z1177:Gon4l	UTSW	3	88859036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGCCACTACAGTAAAGGTTG -3'
(R):5'- TTCAGAGAATGCTTCCTGGC -3'

Sequencing Primer
(F):5'- CCACTACAGTAAAGGTTGTGAGC -3'
(R):5'- CCGTATCTGCTGAAGAATGCCAG -3'

Posted On

2019-05-15