Incidental Mutation 'R7128:Mlxipl'
ID 552451
Institutional Source Beutler Lab
Gene Symbol Mlxipl
Ensembl Gene ENSMUSG00000005373
Gene Name MLX interacting protein-like
Synonyms WS-bHLH, Wbscr14, bHLHd14, ChREBP
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock # R7128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 135089890-135138382 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135133851 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 691 (L691P)
Ref Sequence ENSEMBL: ENSMUSP00000005507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519]
AlphaFold Q99MZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000005507
AA Change: L691P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373
AA Change: L691P

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 1e-8 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
HLH 667 721 1.14e-9 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116358
Gene: ENSMUSG00000005373
AA Change: L42P

DomainStartEndE-ValueType
HLH 19 73 1.14e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128691
AA Change: L691P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373
AA Change: L691P

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1hloa_ 658 709 6e-7 SMART
Blast:HLH 667 699 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129008
SMART Domains Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142385
SMART Domains Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153519
AA Change: L691P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373
AA Change: L691P

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1am9a_ 658 696 1e-5 SMART
Blast:HLH 667 698 2e-12 BLAST
low complexity region 728 744 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373
AA Change: L49P

DomainStartEndE-ValueType
HLH 26 120 7.9e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in Mlxipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Mlxipl APN 5 135132778 missense probably damaging 0.98
IGL01872:Mlxipl APN 5 135113691 missense probably damaging 1.00
IGL02694:Mlxipl APN 5 135124018 critical splice donor site probably null
IGL03070:Mlxipl APN 5 135132453 missense possibly damaging 0.93
Scarlet UTSW 5 135134030 missense possibly damaging 0.93
H8441:Mlxipl UTSW 5 135123961 missense probably damaging 1.00
IGL03054:Mlxipl UTSW 5 135133256 missense possibly damaging 0.83
R0003:Mlxipl UTSW 5 135133189 unclassified probably benign
R0126:Mlxipl UTSW 5 135132323 missense probably damaging 0.96
R0458:Mlxipl UTSW 5 135133370 missense probably benign 0.33
R0513:Mlxipl UTSW 5 135137263 missense probably benign 0.33
R0580:Mlxipl UTSW 5 135123975 missense probably benign 0.01
R0744:Mlxipl UTSW 5 135132475 missense possibly damaging 0.86
R0827:Mlxipl UTSW 5 135132738 missense probably benign 0.00
R1052:Mlxipl UTSW 5 135113710 missense probably damaging 1.00
R1241:Mlxipl UTSW 5 135132718 missense probably benign 0.01
R1795:Mlxipl UTSW 5 135107170 missense probably damaging 1.00
R1903:Mlxipl UTSW 5 135133568 missense possibly damaging 0.92
R2038:Mlxipl UTSW 5 135106999 missense probably damaging 1.00
R2064:Mlxipl UTSW 5 135132777 missense possibly damaging 0.77
R2069:Mlxipl UTSW 5 135107005 missense probably damaging 1.00
R2081:Mlxipl UTSW 5 135113638 missense probably damaging 1.00
R2095:Mlxipl UTSW 5 135122120 splice site probably benign
R3114:Mlxipl UTSW 5 135133662 splice site probably benign
R4018:Mlxipl UTSW 5 135132672 missense probably damaging 1.00
R4090:Mlxipl UTSW 5 135132527 missense probably benign 0.33
R4321:Mlxipl UTSW 5 135135450 nonsense probably null
R4414:Mlxipl UTSW 5 135137399 unclassified probably benign
R5706:Mlxipl UTSW 5 135133604 missense probably benign 0.33
R6088:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R6508:Mlxipl UTSW 5 135128620 missense probably benign 0.03
R6704:Mlxipl UTSW 5 135137240 critical splice acceptor site probably null
R7060:Mlxipl UTSW 5 135132315 missense possibly damaging 0.88
R7095:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R7464:Mlxipl UTSW 5 135133628 missense probably benign 0.01
R7510:Mlxipl UTSW 5 135133118 missense possibly damaging 0.72
R7669:Mlxipl UTSW 5 135132370 missense possibly damaging 0.53
R7737:Mlxipl UTSW 5 135135381 missense possibly damaging 0.73
R7806:Mlxipl UTSW 5 135134543 missense possibly damaging 0.93
R7910:Mlxipl UTSW 5 135132409 missense possibly damaging 0.85
R8118:Mlxipl UTSW 5 135137248 missense possibly damaging 0.96
R8363:Mlxipl UTSW 5 135107076 missense probably benign 0.18
R8701:Mlxipl UTSW 5 135107191 missense possibly damaging 0.53
R8725:Mlxipl UTSW 5 135128629 missense probably benign 0.01
R9235:Mlxipl UTSW 5 135128687 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TAGACAACAACAAGGTACGTGC -3'
(R):5'- TGCAGCATCAGGATGTACTCC -3'

Sequencing Primer
(F):5'- AACAAGGTACGTGCCGTCC -3'
(R):5'- GATGTACTCCGCTGTCTTCTGAAG -3'
Posted On 2019-05-15