Incidental Mutation 'R7128:Aldh1l1'
ID552454
Institutional Source Beutler Lab
Gene Symbol Aldh1l1
Ensembl Gene ENSMUSG00000030088
Gene Namealdehyde dehydrogenase 1 family, member L1
SynonymsFthfd, 1810048F20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7128 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90486427-90600203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90563379 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 215 (Q215H)
Ref Sequence ENSEMBL: ENSMUSP00000032175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032175] [ENSMUST00000130418] [ENSMUST00000203111] [ENSMUST00000204796]
Predicted Effect probably benign
Transcript: ENSMUST00000032175
AA Change: Q215H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032175
Gene: ENSMUSG00000030088
AA Change: Q215H

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 6.9e-53 PFAM
Pfam:Formyl_trans_C 204 310 4e-18 PFAM
Pfam:PP-binding 325 391 3.7e-6 PFAM
Pfam:Aldedh 430 898 1.3e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130418
AA Change: Q215H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114304
Gene: ENSMUSG00000030088
AA Change: Q215H

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 7.4e-54 PFAM
Pfam:Formyl_trans_C 204 310 2.6e-18 PFAM
Pfam:Aldedh 430 898 1.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203111
SMART Domains Protein: ENSMUSP00000145233
Gene: ENSMUSG00000030088

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 4 135 4.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204796
AA Change: Q215H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145380
Gene: ENSMUSG00000030088
AA Change: Q215H

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 3e-53 PFAM
Pfam:Formyl_trans_C 204 310 1.5e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in Aldh1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Aldh1l1 APN 6 90598380 missense probably damaging 1.00
IGL01350:Aldh1l1 APN 6 90559356 missense probably damaging 1.00
IGL01601:Aldh1l1 APN 6 90591841 missense probably damaging 1.00
IGL01686:Aldh1l1 APN 6 90559233 splice site probably benign
IGL01868:Aldh1l1 APN 6 90583230 nonsense probably null
IGL01941:Aldh1l1 APN 6 90562695 missense probably damaging 0.98
IGL01982:Aldh1l1 APN 6 90559863 missense probably benign 0.00
IGL02088:Aldh1l1 APN 6 90580590 splice site probably benign
IGL02159:Aldh1l1 APN 6 90594656 splice site probably benign
IGL02450:Aldh1l1 APN 6 90569873 missense probably benign 0.00
IGL02657:Aldh1l1 APN 6 90590794 missense probably damaging 1.00
IGL02839:Aldh1l1 APN 6 90569875 missense possibly damaging 0.95
R0149:Aldh1l1 UTSW 6 90589414 missense possibly damaging 0.85
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0418:Aldh1l1 UTSW 6 90569893 missense possibly damaging 0.49
R1121:Aldh1l1 UTSW 6 90589384 missense probably benign
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1649:Aldh1l1 UTSW 6 90564389 missense probably benign
R1793:Aldh1l1 UTSW 6 90577831 missense possibly damaging 0.92
R2043:Aldh1l1 UTSW 6 90557332 missense probably benign 0.05
R2044:Aldh1l1 UTSW 6 90562665 missense probably benign 0.00
R2229:Aldh1l1 UTSW 6 90583186 missense probably damaging 1.00
R2426:Aldh1l1 UTSW 6 90598284 missense probably damaging 0.99
R4109:Aldh1l1 UTSW 6 90562644 missense probably benign 0.04
R4818:Aldh1l1 UTSW 6 90596915 missense probably benign
R5214:Aldh1l1 UTSW 6 90563417 missense probably damaging 1.00
R5285:Aldh1l1 UTSW 6 90576770 nonsense probably null
R5426:Aldh1l1 UTSW 6 90559299 missense probably benign
R5516:Aldh1l1 UTSW 6 90596945 missense possibly damaging 0.95
R5970:Aldh1l1 UTSW 6 90597046 intron probably benign
R6235:Aldh1l1 UTSW 6 90564457 missense probably benign 0.44
R6322:Aldh1l1 UTSW 6 90562698 missense probably benign 0.03
R7053:Aldh1l1 UTSW 6 90563438 missense possibly damaging 0.50
R7125:Aldh1l1 UTSW 6 90576779 critical splice donor site probably null
R7142:Aldh1l1 UTSW 6 90563416 missense probably damaging 1.00
R7203:Aldh1l1 UTSW 6 90570800 missense probably benign 0.01
R7205:Aldh1l1 UTSW 6 90598275 missense probably damaging 0.97
R7477:Aldh1l1 UTSW 6 90598387 critical splice donor site probably null
R7669:Aldh1l1 UTSW 6 90570862 missense probably benign
R7718:Aldh1l1 UTSW 6 90598323 missense probably damaging 1.00
R7788:Aldh1l1 UTSW 6 90569912 missense probably benign 0.20
RF007:Aldh1l1 UTSW 6 90598259 missense probably damaging 0.99
Z1176:Aldh1l1 UTSW 6 90557284 frame shift probably null
Z1176:Aldh1l1 UTSW 6 90583173 missense probably benign 0.11
Z1177:Aldh1l1 UTSW 6 90564449 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATTCTACAGGCTGTGCAG -3'
(R):5'- TGGTACAGGGTCTCCTAGTC -3'

Sequencing Primer
(F):5'- CTGTGCAGGGAGAGAACTC -3'
(R):5'- TACAGGGTCTCCTAGTCCTGGAG -3'
Posted On2019-05-15