Incidental Mutation 'R7128:AW822073'
ID 552472
Institutional Source Beutler Lab
Gene Symbol AW822073
Ensembl Gene ENSMUSG00000058537
Gene Name expressed sequence AW822073
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7128 (G1)
Quality Score 147.008
Status Not validated
Chromosome 10
Chromosomal Location 58222972-58224930 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58223657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 425 (Q425R)
Ref Sequence ENSEMBL: ENSMUSP00000144714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075305] [ENSMUST00000204003]
AlphaFold A0A0N4SUK1
Predicted Effect probably benign
Transcript: ENSMUST00000075305
SMART Domains Protein: ENSMUSP00000074777
Gene: ENSMUSG00000058537

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204003
AA Change: Q425R
SMART Domains Protein: ENSMUSP00000144714
Gene: ENSMUSG00000058537
AA Change: Q425R

DomainStartEndE-ValueType
HOX 2 58 5e-7 SMART
HOX 90 152 4.5e-25 SMART
internal_repeat_1 172 298 5.65e-42 PROSPERO
low complexity region 327 338 N/A INTRINSIC
low complexity region 394 414 N/A INTRINSIC
low complexity region 419 434 N/A INTRINSIC
internal_repeat_1 446 573 5.65e-42 PROSPERO
low complexity region 577 597 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in AW822073
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:AW822073 UTSW 10 58223454 missense probably benign 0.00
PIT4131001:AW822073 UTSW 10 58224314 unclassified probably benign
PIT4131001:AW822073 UTSW 10 58224882 missense possibly damaging 0.71
PIT4142001:AW822073 UTSW 10 58223454 missense probably benign 0.00
PIT4142001:AW822073 UTSW 10 58223456 missense probably damaging 1.00
PIT4142001:AW822073 UTSW 10 58224314 unclassified probably benign
PIT4142001:AW822073 UTSW 10 58224882 missense possibly damaging 0.71
R0583:AW822073 UTSW 10 58223388 missense probably damaging 0.99
R4904:AW822073 UTSW 10 58223487 nonsense probably null
R6377:AW822073 UTSW 10 58223672 unclassified probably benign
R7000:AW822073 UTSW 10 58222992 missense possibly damaging 0.53
R7701:AW822073 UTSW 10 58223063 missense possibly damaging 0.71
R8062:AW822073 UTSW 10 58223810 missense unknown
R8789:AW822073 UTSW 10 58223604 missense unknown
R9040:AW822073 UTSW 10 58223786 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGACTCTCTGCAGAAGGAG -3'
(R):5'- GTAGAAATTCTGGCAGCTGGG -3'

Sequencing Primer
(F):5'- ACTCTCTGCAGAAGGAGTTTGAGTC -3'
(R):5'- AAGGTTCCCAGGATAGCTTACTGC -3'
Posted On 2019-05-15