Incidental Mutation 'R0599:Kdm1b'
ID55248
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Namelysine (K)-specific demethylase 1B
Synonyms4632428N09Rik, Aof1
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R0599 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location47043499-47085279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47058810 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 190 (D190V)
Ref Sequence ENSEMBL: ENSMUSP00000038373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037025
AA Change: D190V

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080
AA Change: D190V

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Meta Mutation Damage Score 0.3057 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47064231 critical splice donor site probably null
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47062969 missense probably benign 0.35
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47068536 missense probably benign 0.00
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
R7831:Kdm1b UTSW 13 47050622 missense probably benign 0.17
R7973:Kdm1b UTSW 13 47077446 missense probably benign 0.00
R8181:Kdm1b UTSW 13 47051901 critical splice donor site probably null
R8248:Kdm1b UTSW 13 47071878 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAAAGTGCCAATCTTCCCACACTC -3'
(R):5'- GGTCCTGCAACTACAGTATCACCAC -3'

Sequencing Primer
(F):5'- GCATTTTTCTTGCCAGTTAAATAGGG -3'
(R):5'- ACCATCACCATCTATGACTGTG -3'
Posted On2013-07-11