Incidental Mutation 'R7128:Catsper3'
ID552482
Institutional Source Beutler Lab
Gene Symbol Catsper3
Ensembl Gene ENSMUSG00000021499
Gene Namecation channel, sperm associated 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7128 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55784568-55808998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55798849 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 120 (I120V)
Ref Sequence ENSEMBL: ENSMUSP00000021961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021961] [ENSMUST00000109898]
Predicted Effect probably benign
Transcript: ENSMUST00000021961
AA Change: I120V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021961
Gene: ENSMUSG00000021499
AA Change: I120V

DomainStartEndE-ValueType
Pfam:Ion_trans 49 277 1.8e-33 PFAM
Pfam:PKD_channel 144 273 5e-7 PFAM
coiled coil region 283 311 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109898
AA Change: I107V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105524
Gene: ENSMUSG00000021499
AA Change: I107V

DomainStartEndE-ValueType
Pfam:Ion_trans 72 254 4.9e-32 PFAM
Pfam:PKD_channel 125 261 2.1e-7 PFAM
coiled coil region 270 298 N/A INTRINSIC
low complexity region 374 382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for this mutation are viable and exhibit no gross physical or behavioral abnormality. Although wild-type and homozygous mutant females bred to wild-type males exhibit similar fertility, male homozygotes are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in Catsper3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Catsper3 APN 13 55798822 missense possibly damaging 0.94
IGL01794:Catsper3 APN 13 55798906 missense possibly damaging 0.84
IGL02419:Catsper3 APN 13 55808068 missense possibly damaging 0.94
IGL03108:Catsper3 APN 13 55808035 missense probably benign 0.01
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R1870:Catsper3 UTSW 13 55805748 missense probably damaging 1.00
R2229:Catsper3 UTSW 13 55808054 missense probably damaging 1.00
R3055:Catsper3 UTSW 13 55808896 missense unknown
R3056:Catsper3 UTSW 13 55808896 missense unknown
R4092:Catsper3 UTSW 13 55784671 missense probably benign 0.00
R4113:Catsper3 UTSW 13 55786370 missense probably damaging 0.99
R5197:Catsper3 UTSW 13 55808176 critical splice donor site probably null
R6011:Catsper3 UTSW 13 55786492 missense probably damaging 0.96
R6064:Catsper3 UTSW 13 55806252 missense probably damaging 0.99
R6385:Catsper3 UTSW 13 55786426 missense probably damaging 0.99
R6966:Catsper3 UTSW 13 55798859 missense probably damaging 0.98
R7373:Catsper3 UTSW 13 55808132 missense possibly damaging 0.87
R7565:Catsper3 UTSW 13 55784725 missense probably benign 0.10
Z1088:Catsper3 UTSW 13 55808104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATAGGGTGGTCTCAGCAG -3'
(R):5'- TCGGTCAAGTTTAACTGGCCAC -3'

Sequencing Primer
(F):5'- TGGTCTCAGCAGGGAGAG -3'
(R):5'- AGTCATTATTTCTTAGAAAGCCTCCC -3'
Posted On2019-05-15