Incidental Mutation 'R0599:Zcchc6'
ID 55249
Institutional Source Beutler Lab
Gene Symbol Zcchc6
Ensembl Gene ENSMUSG00000035248
Gene Name zinc finger, CCHC domain containing 6
Synonyms 6030448M23Rik
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 59771561-59823147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59809487 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Ref Sequence ENSEMBL: ENSMUSP00000153376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071703] [ENSMUST00000224480]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071703
AA Change: V409A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071623
Gene: ENSMUSG00000035248
AA Change: V409A

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
ZnF_C2H2 244 268 2.61e1 SMART
SCOP:d1f5aa2 284 497 4e-25 SMART
low complexity region 522 534 N/A INTRINSIC
Pfam:PAP_assoc 550 603 6.7e-14 PFAM
low complexity region 811 825 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 882 898 N/A INTRINSIC
ZnF_C2HC 960 976 3.3e-3 SMART
Pfam:NTP_transf_2 1022 1134 4e-8 PFAM
Pfam:PAP_assoc 1229 1282 1.7e-17 PFAM
ZnF_C2HC 1342 1358 2.09e-3 SMART
Pfam:TUTF7_u4 1359 1446 1.6e-42 PFAM
ZnF_C2HC 1448 1464 1.06e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224480
AA Change: V7A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000225241
Meta Mutation Damage Score 0.4554 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Zcchc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Zcchc6 APN 13 59816698 missense probably damaging 1.00
IGL01361:Zcchc6 APN 13 59785800 missense probably damaging 1.00
IGL02002:Zcchc6 APN 13 59782096 missense possibly damaging 0.76
IGL02015:Zcchc6 APN 13 59789258 missense probably damaging 1.00
IGL02029:Zcchc6 APN 13 59784888 unclassified probably benign
IGL02216:Zcchc6 APN 13 59800423 missense probably benign 0.01
IGL02705:Zcchc6 APN 13 59789203 missense probably damaging 1.00
IGL02742:Zcchc6 APN 13 59816342 missense probably damaging 0.99
IGL02810:Zcchc6 APN 13 59782016 critical splice donor site probably null
IGL02942:Zcchc6 APN 13 59811521 missense probably damaging 0.98
IGL03104:Zcchc6 APN 13 59814903 missense probably benign 0.04
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0153:Zcchc6 UTSW 13 59782336 nonsense probably null
R0269:Zcchc6 UTSW 13 59816855 splice site probably null
R0358:Zcchc6 UTSW 13 59782104 missense probably damaging 0.99
R0555:Zcchc6 UTSW 13 59800317 missense probably benign 0.00
R0609:Zcchc6 UTSW 13 59799782 nonsense probably null
R0617:Zcchc6 UTSW 13 59816855 splice site probably null
R0680:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R0699:Zcchc6 UTSW 13 59782014 splice site probably benign
R1214:Zcchc6 UTSW 13 59805326 missense possibly damaging 0.76
R1271:Zcchc6 UTSW 13 59821855 missense probably damaging 0.99
R1556:Zcchc6 UTSW 13 59800240 missense probably benign 0.02
R1662:Zcchc6 UTSW 13 59799903 missense possibly damaging 0.93
R1777:Zcchc6 UTSW 13 59791821 missense probably damaging 1.00
R1834:Zcchc6 UTSW 13 59814935 nonsense probably null
R1928:Zcchc6 UTSW 13 59816734 missense probably damaging 1.00
R2012:Zcchc6 UTSW 13 59811538 missense probably damaging 0.99
R2045:Zcchc6 UTSW 13 59800656 missense probably damaging 1.00
R2336:Zcchc6 UTSW 13 59799054 missense probably damaging 1.00
R3764:Zcchc6 UTSW 13 59800380 missense probably damaging 0.98
R3899:Zcchc6 UTSW 13 59789255 nonsense probably null
R3918:Zcchc6 UTSW 13 59782024 missense probably damaging 1.00
R4423:Zcchc6 UTSW 13 59822049 missense probably damaging 0.96
R4664:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R4673:Zcchc6 UTSW 13 59796845 missense probably damaging 1.00
R4770:Zcchc6 UTSW 13 59772884 unclassified probably benign
R4884:Zcchc6 UTSW 13 59789452 missense probably damaging 1.00
R5186:Zcchc6 UTSW 13 59816656 critical splice donor site probably null
R5337:Zcchc6 UTSW 13 59791852 missense probably damaging 1.00
R5385:Zcchc6 UTSW 13 59789846 critical splice donor site probably null
R5452:Zcchc6 UTSW 13 59800657 missense probably damaging 1.00
R5534:Zcchc6 UTSW 13 59788553 missense probably damaging 1.00
R5566:Zcchc6 UTSW 13 59788629 nonsense probably null
R5928:Zcchc6 UTSW 13 59822066 missense probably benign 0.16
R5994:Zcchc6 UTSW 13 59789209 missense probably damaging 1.00
R6415:Zcchc6 UTSW 13 59816296 splice site probably null
R6495:Zcchc6 UTSW 13 59799939 missense possibly damaging 0.95
R6577:Zcchc6 UTSW 13 59808161 missense probably damaging 1.00
R7205:Zcchc6 UTSW 13 59788550 missense probably damaging 1.00
R7286:Zcchc6 UTSW 13 59821649 missense probably benign 0.18
R7355:Zcchc6 UTSW 13 59821802 missense probably benign 0.00
R7369:Zcchc6 UTSW 13 59782053 missense possibly damaging 0.71
R7455:Zcchc6 UTSW 13 59822057 missense probably benign 0.03
R7557:Zcchc6 UTSW 13 59788466 missense possibly damaging 0.89
R7635:Zcchc6 UTSW 13 59800090 missense probably benign 0.03
R7727:Zcchc6 UTSW 13 59799682 missense probably benign 0.00
R7798:Zcchc6 UTSW 13 59815575 missense possibly damaging 0.81
R7912:Zcchc6 UTSW 13 59799005 missense probably damaging 1.00
R7915:Zcchc6 UTSW 13 59784814 missense probably benign 0.12
R8035:Zcchc6 UTSW 13 59789190 missense probably benign 0.00
R8531:Zcchc6 UTSW 13 59789260 missense probably damaging 1.00
R8777:Zcchc6 UTSW 13 59785783 missense probably benign 0.15
R8777-TAIL:Zcchc6 UTSW 13 59785783 missense probably benign 0.15
R8850:Zcchc6 UTSW 13 59789197 missense possibly damaging 0.83
R8929:Zcchc6 UTSW 13 59800128 missense probably benign
R9254:Zcchc6 UTSW 13 59788474 missense possibly damaging 0.48
R9313:Zcchc6 UTSW 13 59799984 missense probably benign 0.01
R9373:Zcchc6 UTSW 13 59796867 missense probably damaging 1.00
R9379:Zcchc6 UTSW 13 59788474 missense possibly damaging 0.48
R9404:Zcchc6 UTSW 13 59799887 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAATCAAGAACAaggaggaggaggaa -3'
(R):5'- GCTCTGCTGACTCGTCATTAAGCAAA -3'

Sequencing Primer
(F):5'- ggaggaggaggaagaggaag -3'
(R):5'- ttgattcccagcacccac -3'
Posted On 2013-07-11