Incidental Mutation 'R7128:Galnt14'
ID 552490
Institutional Source Beutler Lab
Gene Symbol Galnt14
Ensembl Gene ENSMUSG00000024064
Gene Name polypeptide N-acetylgalactosaminyltransferase 14
Synonyms 0610033M06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 73493228-73710453 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73545101 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 108 (T108A)
Ref Sequence ENSEMBL: ENSMUSP00000024858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024858] [ENSMUST00000112591]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024858
AA Change: T108A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024858
Gene: ENSMUSG00000024064
AA Change: T108A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 111 359 1.4e-10 PFAM
Pfam:Glycos_transf_2 114 294 7.5e-30 PFAM
Pfam:Glyco_tranf_2_2 114 333 1.5e-8 PFAM
Pfam:Glyco_transf_7C 271 340 7e-8 PFAM
RICIN 420 548 7.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112591
AA Change: T108A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108210
Gene: ENSMUSG00000024064
AA Change: T108A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 111 359 1.1e-10 PFAM
Pfam:Glycos_transf_2 114 291 2.4e-27 PFAM
Pfam:Glyco_tranf_2_2 114 333 1.7e-8 PFAM
Pfam:Glyco_transf_7C 270 340 9e-8 PFAM
low complexity region 415 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Golgi protein which is a member of the polypeptide N-acetylgalactosaminyltransferase (ppGalNAc-Ts) protein family. These enzymes catalyze the transfer of N-acetyl-D-galactosamine (GalNAc) to the hydroxyl groups on serines and threonines in target peptides. The encoded protein has been shown to transfer GalNAc to large proteins like mucins. Alterations in this gene may play a role in cancer progression and response to chemotherapy. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in Galnt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Galnt14 APN 17 73494232 missense probably damaging 1.00
IGL01295:Galnt14 APN 17 73504919 missense probably benign 0.01
IGL01578:Galnt14 APN 17 73535366 splice site probably benign
IGL01833:Galnt14 APN 17 73504904 missense probably benign
IGL02572:Galnt14 APN 17 73535267 missense probably damaging 1.00
IGL02890:Galnt14 APN 17 73509524 critical splice donor site probably null
IGL03145:Galnt14 APN 17 73504908 missense possibly damaging 0.63
IGL03175:Galnt14 APN 17 73522654 missense probably damaging 1.00
R0051:Galnt14 UTSW 17 73507859 missense probably benign 0.00
R0112:Galnt14 UTSW 17 73574984 splice site probably benign
R0167:Galnt14 UTSW 17 73522720 missense probably damaging 1.00
R0525:Galnt14 UTSW 17 73545081 missense probably damaging 1.00
R0675:Galnt14 UTSW 17 73545035 missense probably damaging 1.00
R1192:Galnt14 UTSW 17 73545138 splice site probably benign
R1335:Galnt14 UTSW 17 73526290 missense probably damaging 1.00
R1549:Galnt14 UTSW 17 73525313 missense possibly damaging 0.79
R1824:Galnt14 UTSW 17 73709939 missense probably benign 0.01
R2061:Galnt14 UTSW 17 73512153 missense probably damaging 1.00
R2259:Galnt14 UTSW 17 73494266 missense probably benign 0.00
R3844:Galnt14 UTSW 17 73709929 critical splice donor site probably null
R4257:Galnt14 UTSW 17 73504904 missense probably benign
R4364:Galnt14 UTSW 17 73512159 missense probably damaging 0.99
R4664:Galnt14 UTSW 17 73507813 intron probably benign
R4744:Galnt14 UTSW 17 73507833 missense probably damaging 1.00
R4810:Galnt14 UTSW 17 73512121 missense probably damaging 0.99
R4840:Galnt14 UTSW 17 73504898 missense probably benign 0.01
R4846:Galnt14 UTSW 17 73536893 missense probably benign 0.19
R5328:Galnt14 UTSW 17 73505459 missense possibly damaging 0.46
R5507:Galnt14 UTSW 17 73495666 missense probably damaging 0.98
R5816:Galnt14 UTSW 17 73574882 missense probably damaging 1.00
R5872:Galnt14 UTSW 17 73574831 missense probably damaging 1.00
R5933:Galnt14 UTSW 17 73526305 missense probably benign 0.01
R6490:Galnt14 UTSW 17 73525370 missense probably damaging 0.98
R7117:Galnt14 UTSW 17 73494195 missense probably benign 0.00
R7451:Galnt14 UTSW 17 73574809 missense probably benign 0.00
R7604:Galnt14 UTSW 17 73504921 missense possibly damaging 0.94
R7786:Galnt14 UTSW 17 73709981 missense probably benign 0.00
R8693:Galnt14 UTSW 17 73526262 missense probably damaging 1.00
X0067:Galnt14 UTSW 17 73509526 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGACTGGTACCTGGTATGTGCC -3'
(R):5'- TCCCACTGTTAGGAGATGCTG -3'

Sequencing Primer
(F):5'- TATGTGCCTGCAGGATGCC -3'
(R):5'- AGATGCTGTCCTTGAACTCAG -3'
Posted On 2019-05-15