Incidental Mutation 'R7128:Pdzd7'
ID 552495
Institutional Source Beutler Lab
Gene Symbol Pdzd7
Ensembl Gene ENSMUSG00000074818
Gene Name PDZ domain containing 7
Synonyms Pdzk7, EG435601
Accession Numbers

Genbank: NM_001195265

Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R7128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 45026906-45046614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45027949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 911 (D911G)
Ref Sequence ENSEMBL: ENSMUSP00000119002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039016] [ENSMUST00000145391] [ENSMUST00000169459] [ENSMUST00000178087] [ENSMUST00000179108]
AlphaFold E9Q9W7
Predicted Effect probably benign
Transcript: ENSMUST00000039016
SMART Domains Protein: ENSMUSP00000045478
Gene: ENSMUSG00000035342

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145391
AA Change: D911G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818
AA Change: D911G

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169459
AA Change: D911G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818
AA Change: D911G

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178087
SMART Domains Protein: ENSMUSP00000136405
Gene: ENSMUSG00000035342

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 638 2.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179108
SMART Domains Protein: ENSMUSP00000137571
Gene: ENSMUSG00000035342

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit profound deafness due to abnormal outer cochlear hair cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in Pdzd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Pdzd7 APN 19 45040258 missense probably damaging 1.00
IGL02729:Pdzd7 APN 19 45045643 start codon destroyed probably null 0.89
F6893:Pdzd7 UTSW 19 45036734 missense probably damaging 0.98
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0295:Pdzd7 UTSW 19 45037072 missense probably benign 0.01
R0523:Pdzd7 UTSW 19 45036090 missense probably benign 0.01
R0645:Pdzd7 UTSW 19 45045475 missense possibly damaging 0.95
R0731:Pdzd7 UTSW 19 45029305 missense probably damaging 1.00
R1265:Pdzd7 UTSW 19 45040685 missense possibly damaging 0.64
R1711:Pdzd7 UTSW 19 45045511 missense possibly damaging 0.68
R1789:Pdzd7 UTSW 19 45039228 missense probably damaging 1.00
R1817:Pdzd7 UTSW 19 45036176 missense probably damaging 0.98
R2162:Pdzd7 UTSW 19 45036055 critical splice donor site probably null
R2851:Pdzd7 UTSW 19 45027674 missense probably benign
R2852:Pdzd7 UTSW 19 45027674 missense probably benign
R2939:Pdzd7 UTSW 19 45045423 missense possibly damaging 0.89
R3832:Pdzd7 UTSW 19 45040254 missense probably damaging 1.00
R3874:Pdzd7 UTSW 19 45045628 missense probably benign
R4416:Pdzd7 UTSW 19 45040580 missense probably damaging 1.00
R4668:Pdzd7 UTSW 19 45045687 start gained probably benign
R5133:Pdzd7 UTSW 19 45028429 missense possibly damaging 0.51
R5327:Pdzd7 UTSW 19 45028777 missense probably benign
R5458:Pdzd7 UTSW 19 45027791 missense probably benign
R5480:Pdzd7 UTSW 19 45039285 missense possibly damaging 0.65
R5644:Pdzd7 UTSW 19 45040180 missense probably benign 0.16
R5799:Pdzd7 UTSW 19 45036989 missense probably benign 0.06
R5812:Pdzd7 UTSW 19 45036871 missense probably damaging 1.00
R5873:Pdzd7 UTSW 19 45027949 missense probably damaging 1.00
R6669:Pdzd7 UTSW 19 45036751 missense possibly damaging 0.94
R6750:Pdzd7 UTSW 19 45027748 missense probably benign
R7183:Pdzd7 UTSW 19 45037114 missense probably benign
R7378:Pdzd7 UTSW 19 45045606 missense probably damaging 0.99
R7395:Pdzd7 UTSW 19 45037011 missense probably damaging 1.00
R7426:Pdzd7 UTSW 19 45033647 missense possibly damaging 0.68
R7790:Pdzd7 UTSW 19 45045523 nonsense probably null
R7792:Pdzd7 UTSW 19 45040218 missense possibly damaging 0.54
R7829:Pdzd7 UTSW 19 45039239 missense probably benign 0.00
R7883:Pdzd7 UTSW 19 45030240 missense probably damaging 1.00
R7969:Pdzd7 UTSW 19 45036225 missense probably benign 0.01
R8387:Pdzd7 UTSW 19 45030051 missense probably damaging 1.00
R8720:Pdzd7 UTSW 19 45036228 missense probably benign 0.27
R8830:Pdzd7 UTSW 19 45033073 missense probably damaging 1.00
R9282:Pdzd7 UTSW 19 45040183 missense probably damaging 0.96
R9417:Pdzd7 UTSW 19 45045583 missense not run
Predicted Primers PCR Primer
(F):5'- CATCATCAACAGGTCCAAGGG -3'
(R):5'- ACAAAGGGCCATTGTCTGTGC -3'

Sequencing Primer
(F):5'- CAGGTCCAAGGGCGGAG -3'
(R):5'- TGCCCCCAACAGCTGCAG -3'
Posted On 2019-05-15