Incidental Mutation 'R7129:Nmi'
ID552497
Institutional Source Beutler Lab
Gene Symbol Nmi
Ensembl Gene ENSMUSG00000026946
Gene NameN-myc (and STAT) interactor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location51948487-51973494 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 51955924 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028314] [ENSMUST00000112705] [ENSMUST00000142868] [ENSMUST00000145481] [ENSMUST00000145656]
Predicted Effect probably null
Transcript: ENSMUST00000028314
SMART Domains Protein: ENSMUSP00000028314
Gene: ENSMUSG00000026946

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 7.6e-39 PFAM
Pfam:NID 106 193 3.7e-49 PFAM
Pfam:NID 204 292 1.8e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112705
SMART Domains Protein: ENSMUSP00000108325
Gene: ENSMUSG00000026946

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 7.6e-39 PFAM
Pfam:NID 106 193 3.7e-49 PFAM
Pfam:NID 204 292 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142868
SMART Domains Protein: ENSMUSP00000115428
Gene: ENSMUSG00000026946

DomainStartEndE-ValueType
Pfam:NID 1 26 3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145481
SMART Domains Protein: ENSMUSP00000120647
Gene: ENSMUSG00000026946

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 3.7e-41 PFAM
Pfam:NID 106 193 7.3e-34 PFAM
Pfam:NID 204 292 2.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145656
SMART Domains Protein: ENSMUSP00000122318
Gene: ENSMUSG00000026946

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 75 1.3e-22 PFAM
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NMYC interactor (NMI) encodes a protein that interacts with NMYC and CMYC (two members of the oncogene Myc family), and other transcription factors containing a Zip, HLH, or HLH-Zip motif. The NMI protein also interacts with all STATs except STAT2 and augments STAT-mediated transcription in response to cytokines IL2 and IFN-gamma. The NMI mRNA has low expression levels in all human fetal and adult tissues tested except brain and has high expression in cancer cell line-myeloid leukemias. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Nmi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Nmi APN 2 51956040 unclassified probably null
IGL02041:Nmi APN 2 51960629 missense possibly damaging 0.72
IGL02299:Nmi APN 2 51958964 missense probably damaging 1.00
IGL03144:Nmi APN 2 51952534 missense probably damaging 1.00
R1589:Nmi UTSW 2 51958977 missense possibly damaging 0.62
R1961:Nmi UTSW 2 51948620 missense probably benign 0.01
R2114:Nmi UTSW 2 51948707 missense probably benign 0.30
R2115:Nmi UTSW 2 51948707 missense probably benign 0.30
R2116:Nmi UTSW 2 51948707 missense probably benign 0.30
R2151:Nmi UTSW 2 51952543 missense probably damaging 1.00
R2153:Nmi UTSW 2 51952543 missense probably damaging 1.00
R3964:Nmi UTSW 2 51956069 missense possibly damaging 0.85
R4195:Nmi UTSW 2 51948620 missense probably benign 0.00
R4650:Nmi UTSW 2 51948634 missense probably benign 0.33
R6573:Nmi UTSW 2 51950069 missense possibly damaging 0.55
R7369:Nmi UTSW 2 51950084 missense possibly damaging 0.85
R7520:Nmi UTSW 2 51952480 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGGTGCCCCTAATGCTTGG -3'
(R):5'- GTACTGTCATTGGAAGGCCTTAAG -3'

Sequencing Primer
(F):5'- GGTTTCCTTCTCTGTAAATTGAGAC -3'
(R):5'- GGAAGGCCTTAAGTTATATCTTGC -3'
Posted On2019-05-15