Mutagenetix > Incidental Mutations

Incidental Mutation 'R0599:Itga2'

55250

Institutional Source

Beutler Lab

Gene Symbol

Itga2

Ensembl Gene

ENSMUSG00000015533

Gene Name

integrin alpha 2

Synonyms

VLA-2 receptor, alpha 2 subunit, DX5, CD49B

MMRRC Submission

038788-MU

Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0599 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

114833081-114932100 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 114856650 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000053891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056117]

Predicted Effect

probably benign
Transcript: ENSMUST00000056117

SMART Domains

Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Int_alpha	41	96	4.91e-4	SMART
VWA	169	359	2.42e-39	SMART
Blast:VWA	364	424	4e-26	BLAST
Int_alpha	430	481	2.59e-3	SMART
Int_alpha	484	541	3.5e-9	SMART
Int_alpha	547	602	3.11e-15	SMART
Int_alpha	611	669	2.52e-1	SMART
low complexity region	890	910	N/A	INTRINSIC
transmembrane domain	1129	1151	N/A	INTRINSIC
Pfam:Integrin_alpha	1152	1166	9e-7	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

98% (80/82)

MGI Phenotype

Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,552,245	L978P	probably damaging	Het
Abcb1a	C	T	5: 8,698,539	T290M	probably benign	Het
Abcd3	A	T	3: 121,765,093	F585I	probably damaging	Het
Acan	A	G	7: 79,111,290		probably benign	Het
Anxa6	T	C	11: 54,979,466	D667G	possibly damaging	Het
Ap3m2	G	T	8: 22,793,112	A208D	possibly damaging	Het
Arhgap17	A	T	7: 123,303,790		probably benign	Het
Bptf	A	G	11: 107,068,382	V1838A	probably damaging	Het
Brip1	T	A	11: 86,152,737	M334L	probably benign	Het
Btbd10	C	T	7: 113,335,309		probably benign	Het
Btbd11	G	A	10: 85,658,336	G1106D	probably damaging	Het
Cdh7	C	A	1: 110,052,966	T208K	probably damaging	Het
Cnga4	A	G	7: 105,405,818	Y100C	probably damaging	Het
Dnah10	G	A	5: 124,800,953	V2644M	probably damaging	Het
Dnah9	T	C	11: 65,965,689	D2882G	probably damaging	Het
Eapp	T	A	12: 54,685,962	K117M	probably damaging	Het
Eml3	T	C	19: 8,939,063	V673A	probably benign	Het
Ephb4	G	A	5: 137,369,855	C754Y	probably damaging	Het
Eps8l1	A	G	7: 4,477,957	D33G	possibly damaging	Het
Farsa	A	G	8: 84,867,583	K321E	probably damaging	Het
Fry	G	A	5: 150,437,159	R2090Q	probably damaging	Het
Gm10283	A	G	8: 60,501,224		probably benign	Het
Grm4	A	G	17: 27,431,490	I844T	probably benign	Het
Gtf2h3	A	G	5: 124,588,628	D124G	probably benign	Het
Gulo	A	T	14: 65,990,441	D347E	probably damaging	Het
Hmcn1	A	G	1: 150,609,801	F4350S	possibly damaging	Het
Hspg2	A	G	4: 137,512,401	D473G	probably damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Insrr	A	G	3: 87,813,133	E1026G	probably damaging	Het
Kdm1b	A	T	13: 47,058,810	D190V	possibly damaging	Het
Lima1	A	T	15: 99,802,159	N146K	probably damaging	Het
Mettl7a3	A	T	15: 100,335,383	N152Y	possibly damaging	Het
Mnt	G	T	11: 74,842,296	V85L	probably benign	Het
Mon2	T	A	10: 123,026,065		probably benign	Het
Mtf1	T	C	4: 124,820,201		probably benign	Het
Mylk4	T	C	13: 32,712,754		probably null	Het
Myo18b	A	C	5: 112,865,750	L780R	probably damaging	Het
Myo1e	A	G	9: 70,376,660		probably benign	Het
Obscn	A	G	11: 59,073,696	S705P	probably damaging	Het
Ocrl	A	T	X: 47,936,086		probably benign	Het
Olfr1260	T	C	2: 89,978,201	F141S	probably benign	Het
Olfr394	A	T	11: 73,887,904	M156K	probably benign	Het
Olfr599	A	G	7: 103,338,186	N44S	probably damaging	Het
Olfr639	A	T	7: 104,012,188	C171*	probably null	Het
Otof	T	A	5: 30,370,705	K1931N	probably damaging	Het
Plcxd3	A	G	15: 4,516,867	S118G	probably damaging	Het
Plcz1	T	A	6: 140,028,542	Q58L	probably benign	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Rassf4	T	C	6: 116,645,936	E38G	probably damaging	Het
Ros1	A	T	10: 52,123,300	Y1164N	probably damaging	Het
Rpgrip1l	A	G	8: 91,305,000	I83T	probably damaging	Het
Scn9a	T	G	2: 66,526,799	K1053Q	probably damaging	Het
Sgsm1	G	T	5: 113,245,028	Q1087K	probably damaging	Het
Slc16a10	T	C	10: 40,141,918	D40G	probably benign	Het
Slc27a6	A	G	18: 58,556,813	D117G	probably damaging	Het
Slc2a9	T	A	5: 38,480,144		probably benign	Het
Slc4a1	A	G	11: 102,357,915		probably benign	Het
Smarca1	T	A	X: 47,823,426	Q982L	probably benign	Het
Sp100	T	A	1: 85,681,110	I320N	possibly damaging	Het
Stx8	A	T	11: 68,109,362	R209S	probably null	Het
Sulf2	T	C	2: 166,083,879	T453A	possibly damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tenm2	T	A	11: 36,024,780	I1976F	possibly damaging	Het
Tenm3	G	A	8: 48,277,710	S1341L	probably damaging	Het
Tmem130	C	T	5: 144,737,809	V369M	probably damaging	Het
Tmem200c	A	G	17: 68,840,511	K30E	probably damaging	Het
Tmem225	A	G	9: 40,149,747	I117V	possibly damaging	Het
Top2a	A	G	11: 99,001,417	I1073T	probably damaging	Het
Trps1	A	C	15: 50,831,860	Y296*	probably null	Het
Tubg1	T	C	11: 101,125,336	M377T	probably benign	Het
Vmn1r35	G	A	6: 66,679,513	H58Y	probably benign	Het
Vmn1r56	G	A	7: 5,196,430	H63Y	probably benign	Het
Vmn1r75	T	C	7: 11,881,262		probably null	Het
Vnn3	T	C	10: 23,865,705	S303P	possibly damaging	Het
Wdr49	C	T	3: 75,431,076		probably null	Het
Wdr49	T	C	3: 75,449,890		probably null	Het
Zcchc6	A	G	13: 59,809,487	V7A	probably damaging	Het
Zzef1	T	C	11: 72,913,178	L2582P	probably damaging	Het

Other mutations in Itga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Itga2	APN	13	114877625	missense	probably damaging	0.99
IGL01481:Itga2	APN	13	114859632	missense	possibly damaging	0.63
IGL01666:Itga2	APN	13	114837091	critical splice donor site	probably null
IGL01730:Itga2	APN	13	114854411	splice site	probably benign
IGL01965:Itga2	APN	13	114848064	splice site	probably benign
IGL01987:Itga2	APN	13	114847946	nonsense	probably null
IGL02334:Itga2	APN	13	114865309	critical splice donor site	probably null
IGL02381:Itga2	APN	13	114856722	missense	probably damaging	1.00
IGL02562:Itga2	APN	13	114836570	unclassified	probably benign
IGL03191:Itga2	APN	13	114836484	unclassified	probably benign
IGL03209:Itga2	APN	13	114880632	missense	probably damaging	1.00
P0007:Itga2	UTSW	13	114866199	missense	probably damaging	1.00
R0023:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0023:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0025:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0029:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0149:Itga2	UTSW	13	114836579	unclassified	probably benign
R0152:Itga2	UTSW	13	114866314	missense	probably benign	0.06
R0496:Itga2	UTSW	13	114853899	missense	probably benign	0.00
R0502:Itga2	UTSW	13	114845856	missense	probably benign	0.15
R0688:Itga2	UTSW	13	114839554	missense	probably benign	0.00
R0704:Itga2	UTSW	13	114862375	missense	possibly damaging	0.91
R0760:Itga2	UTSW	13	114859632	missense	possibly damaging	0.63
R0811:Itga2	UTSW	13	114870614	missense	possibly damaging	0.92
R0812:Itga2	UTSW	13	114870614	missense	possibly damaging	0.92
R0836:Itga2	UTSW	13	114856679	missense	probably damaging	0.99
R1196:Itga2	UTSW	13	114866155	critical splice donor site	probably null
R1546:Itga2	UTSW	13	114849420	missense	possibly damaging	0.63
R1639:Itga2	UTSW	13	114857296	missense	probably benign	0.00
R1834:Itga2	UTSW	13	114856726	missense	probably damaging	0.98
R1834:Itga2	UTSW	13	114856727	missense	probably damaging	1.00
R2180:Itga2	UTSW	13	114849381	missense	possibly damaging	0.67
R2190:Itga2	UTSW	13	114870605	missense	probably benign	0.05
R2518:Itga2	UTSW	13	114881042	missense	probably damaging	1.00
R3885:Itga2	UTSW	13	114869299	missense	probably benign	0.35
R3962:Itga2	UTSW	13	114839518	missense	probably damaging	0.99
R4094:Itga2	UTSW	13	114870625	missense	probably benign	0.01
R4193:Itga2	UTSW	13	114886649	nonsense	probably null
R4290:Itga2	UTSW	13	114866173	missense	probably damaging	0.98
R4459:Itga2	UTSW	13	114843483	missense	probably damaging	0.97
R4460:Itga2	UTSW	13	114843483	missense	probably damaging	0.97
R4628:Itga2	UTSW	13	114877693	missense	probably benign	0.03
R4655:Itga2	UTSW	13	114873269	missense	probably benign	0.00
R4716:Itga2	UTSW	13	114857373	missense	probably damaging	0.98
R4896:Itga2	UTSW	13	114853766	nonsense	probably null
R5093:Itga2	UTSW	13	114856181	missense	probably benign	0.00
R5488:Itga2	UTSW	13	114843435	missense	probably damaging	1.00
R5489:Itga2	UTSW	13	114843435	missense	probably damaging	1.00
R5743:Itga2	UTSW	13	114884506	missense	probably damaging	1.00
R5767:Itga2	UTSW	13	114839570	missense	possibly damaging	0.88
R5790:Itga2	UTSW	13	114868206	missense	probably benign	0.02
R5923:Itga2	UTSW	13	114884519	missense	probably benign	0.02
R6163:Itga2	UTSW	13	114866190	missense	probably damaging	1.00
R6227:Itga2	UTSW	13	114839561	missense	probably benign	0.30
R6278:Itga2	UTSW	13	114845888	missense	probably benign	0.05
R6283:Itga2	UTSW	13	114869250	missense	probably damaging	1.00
R6332:Itga2	UTSW	13	114843473	missense	probably benign
R6510:Itga2	UTSW	13	114873280	missense	probably damaging	1.00
R6742:Itga2	UTSW	13	114836525	missense	possibly damaging	0.93
R6869:Itga2	UTSW	13	114875537	splice site	probably null
R7073:Itga2	UTSW	13	114859613	missense	probably damaging	1.00
R7111:Itga2	UTSW	13	114900530	missense	unknown
R7236:Itga2	UTSW	13	114877691	missense	probably benign
R7269:Itga2	UTSW	13	114886689	nonsense	probably null
R7296:Itga2	UTSW	13	114857394	splice site	probably null
R7350:Itga2	UTSW	13	114837202	missense	probably damaging	0.98
R7375:Itga2	UTSW	13	114869217	missense	probably benign	0.06
R7501:Itga2	UTSW	13	114875559	missense	probably damaging	1.00
R7687:Itga2	UTSW	13	114866260	missense	probably damaging	1.00
R7766:Itga2	UTSW	13	114853891	missense	probably benign
R7810:Itga2	UTSW	13	114866179	missense	probably benign	0.15
R8038:Itga2	UTSW	13	114853755	missense	probably damaging	1.00
Z1088:Itga2	UTSW	13	114857332	missense	possibly damaging	0.46
Z1177:Itga2	UTSW	13	114853701	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAAACCCAGCCAGTTAGCATTTC -3'
(R):5'- CCAAGAGCAGTGCCAAGTATCCAAG -3'

Sequencing Primer
(F):5'- AGCCAGTTAGCATTTCTCATTG -3'
(R):5'- tgttcatctctctctactatgcc -3'

Posted On

2013-07-11