Incidental Mutation 'R7129:Elf2'
ID552501
Institutional Source Beutler Lab
Gene Symbol Elf2
Ensembl Gene ENSMUSG00000037174
Gene NameE74-like factor 2
Synonyms2610036A20Rik, A230104O07Rik, NERF-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location51252720-51340663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51261011 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 201 (R201G)
Ref Sequence ENSEMBL: ENSMUSP00000126871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062009] [ENSMUST00000091144] [ENSMUST00000108051] [ENSMUST00000108053] [ENSMUST00000156983] [ENSMUST00000163748] [ENSMUST00000183338] [ENSMUST00000183463] [ENSMUST00000184677] [ENSMUST00000194641] [ENSMUST00000195432]
Predicted Effect probably damaging
Transcript: ENSMUST00000062009
AA Change: R189G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061076
Gene: ENSMUSG00000037174
AA Change: R189G

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 2.2e-37 PFAM
low complexity region 130 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
ETS 195 282 1.28e-51 SMART
low complexity region 357 379 N/A INTRINSIC
low complexity region 411 421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091144
SMART Domains Protein: ENSMUSP00000088678
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 3 108 8.6e-38 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108051
AA Change: R129G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103686
Gene: ENSMUSG00000037174
AA Change: R129G

DomainStartEndE-ValueType
Pfam:Elf-1_N 11 48 4.9e-11 PFAM
low complexity region 70 82 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
ETS 135 222 1.28e-51 SMART
low complexity region 297 319 N/A INTRINSIC
low complexity region 351 361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108053
AA Change: R141G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103688
Gene: ENSMUSG00000037174
AA Change: R141G

DomainStartEndE-ValueType
Pfam:Elf-1_N 11 48 5e-11 PFAM
low complexity region 82 94 N/A INTRINSIC
low complexity region 112 121 N/A INTRINSIC
ETS 147 234 1.28e-51 SMART
low complexity region 309 331 N/A INTRINSIC
low complexity region 363 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156983
SMART Domains Protein: ENSMUSP00000141525
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 7 48 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163748
AA Change: R201G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126871
Gene: ENSMUSG00000037174
AA Change: R201G

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183338
SMART Domains Protein: ENSMUSP00000139358
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 80 3.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183463
SMART Domains Protein: ENSMUSP00000139360
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 85 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184677
SMART Domains Protein: ENSMUSP00000139199
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 10 48 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194641
AA Change: R201G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141197
Gene: ENSMUSG00000037174
AA Change: R201G

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195432
SMART Domains Protein: ENSMUSP00000142300
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 7 48 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Elf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Elf2 APN 3 51308046 critical splice donor site probably benign 0.00
IGL01577:Elf2 APN 3 51256352 utr 3 prime probably benign
IGL01829:Elf2 APN 3 51308100 missense probably damaging 0.98
IGL02974:Elf2 APN 3 51257689 missense probably damaging 0.98
IGL03244:Elf2 APN 3 51257772 nonsense probably null
IGL02980:Elf2 UTSW 3 51264958 missense possibly damaging 0.89
IGL03050:Elf2 UTSW 3 51257617 missense probably benign 0.05
R0254:Elf2 UTSW 3 51308190 missense probably damaging 1.00
R0594:Elf2 UTSW 3 51256453 missense possibly damaging 0.64
R0644:Elf2 UTSW 3 51308131 missense probably damaging 1.00
R1638:Elf2 UTSW 3 51308109 missense probably damaging 1.00
R1729:Elf2 UTSW 3 51257572 missense probably damaging 0.97
R1784:Elf2 UTSW 3 51257572 missense probably damaging 0.97
R2142:Elf2 UTSW 3 51256440 missense probably damaging 1.00
R2346:Elf2 UTSW 3 51257444 missense probably benign
R4366:Elf2 UTSW 3 51308149 nonsense probably null
R4672:Elf2 UTSW 3 51256434 missense probably damaging 1.00
R4834:Elf2 UTSW 3 51277221 missense probably damaging 1.00
R5514:Elf2 UTSW 3 51308134 missense probably damaging 1.00
R6198:Elf2 UTSW 3 51277249 missense probably damaging 1.00
R6870:Elf2 UTSW 3 51294165 makesense probably null
R7328:Elf2 UTSW 3 51266777 missense probably damaging 0.97
R7751:Elf2 UTSW 3 51257614 missense probably damaging 0.99
R7873:Elf2 UTSW 3 51256678 missense probably damaging 1.00
R7956:Elf2 UTSW 3 51256678 missense probably damaging 1.00
R8053:Elf2 UTSW 3 51308130 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTTGGTCCACCCCTAATTGAG -3'
(R):5'- TGAGGATTTCAGTCTGCACATTAG -3'

Sequencing Primer
(F):5'- TTGGTCCACCCCTAATTGAGAAATAC -3'
(R):5'- GCACATTAGTATCTAGTTTAGTGAGG -3'
Posted On2019-05-15