Incidental Mutation 'R7129:Ikbkap'
ID552504
Institutional Source Beutler Lab
Gene Symbol Ikbkap
Ensembl Gene ENSMUSG00000028431
Gene Nameinhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein
SynonymsC78473, Elp1, IKAP, 3110040G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location56749680-56802331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56787944 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 329 (H329R)
Ref Sequence ENSEMBL: ENSMUSP00000030140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030140]
Predicted Effect probably damaging
Transcript: ENSMUST00000030140
AA Change: H329R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030140
Gene: ENSMUSG00000028431
AA Change: H329R

DomainStartEndE-ValueType
Pfam:IKI3 1 955 N/A PFAM
low complexity region 1186 1205 N/A INTRINSIC
low complexity region 1210 1225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scaffold protein and a regulator for three different kinases involved in proinflammatory signaling. The encoded protein can bind NF-kappa-B-inducing kinase and I-kappa-B kinases through separate domains and assemble them into an active kinase complex. Mutations in this gene have been associated with familial dysautonomia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with arrested neural and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Ikbkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ikbkap APN 4 56784537 critical splice donor site probably null
IGL01521:Ikbkap APN 4 56771059 missense probably benign 0.27
IGL02069:Ikbkap APN 4 56779731 missense probably benign 0.31
IGL02162:Ikbkap APN 4 56796502 critical splice donor site probably null
IGL02252:Ikbkap APN 4 56759813 missense probably benign 0.09
IGL02726:Ikbkap APN 4 56767878 critical splice acceptor site probably null
IGL02822:Ikbkap APN 4 56774520 critical splice donor site probably null
IGL03024:Ikbkap APN 4 56774686 critical splice donor site probably null
IGL03126:Ikbkap APN 4 56779717 missense probably benign
R0211:Ikbkap UTSW 4 56795545 missense probably damaging 1.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0603:Ikbkap UTSW 4 56792105 missense possibly damaging 0.94
R1109:Ikbkap UTSW 4 56786723 missense probably benign 0.00
R1314:Ikbkap UTSW 4 56786647 missense probably benign 0.00
R1333:Ikbkap UTSW 4 56770969 splice site probably benign
R1434:Ikbkap UTSW 4 56781193 missense probably benign 0.02
R1547:Ikbkap UTSW 4 56792090 missense probably damaging 1.00
R1547:Ikbkap UTSW 4 56798810 missense probably damaging 1.00
R1587:Ikbkap UTSW 4 56786666 nonsense probably null
R1601:Ikbkap UTSW 4 56774756 nonsense probably null
R2076:Ikbkap UTSW 4 56786620 missense probably damaging 0.98
R2153:Ikbkap UTSW 4 56779636 intron probably null
R2263:Ikbkap UTSW 4 56755298 splice site probably null
R2325:Ikbkap UTSW 4 56784622 missense probably benign 0.00
R2333:Ikbkap UTSW 4 56775456 missense probably benign 0.28
R3151:Ikbkap UTSW 4 56770985 missense probably benign 0.24
R3622:Ikbkap UTSW 4 56759925 splice site probably null
R3624:Ikbkap UTSW 4 56798708 missense possibly damaging 0.52
R3889:Ikbkap UTSW 4 56759852 missense probably damaging 1.00
R4007:Ikbkap UTSW 4 56794139 missense probably damaging 1.00
R4196:Ikbkap UTSW 4 56755353 missense probably damaging 1.00
R4794:Ikbkap UTSW 4 56781176 small deletion probably benign
R5330:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5331:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5360:Ikbkap UTSW 4 56800104 missense probably benign 0.06
R5362:Ikbkap UTSW 4 56778969 missense probably damaging 0.99
R5645:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R5877:Ikbkap UTSW 4 56787807 missense probably damaging 1.00
R6268:Ikbkap UTSW 4 56762305 missense probably damaging 1.00
R6284:Ikbkap UTSW 4 56762281 missense probably damaging 0.99
R6526:Ikbkap UTSW 4 56798812 critical splice acceptor site probably null
R6610:Ikbkap UTSW 4 56758236 missense probably benign 0.02
R6627:Ikbkap UTSW 4 56784647 splice site probably null
R6786:Ikbkap UTSW 4 56771555 missense possibly damaging 0.80
R6823:Ikbkap UTSW 4 56787939 missense probably damaging 1.00
R7157:Ikbkap UTSW 4 56781176 small deletion probably benign
R7180:Ikbkap UTSW 4 56796535 missense probably damaging 1.00
R7391:Ikbkap UTSW 4 56781211 missense possibly damaging 0.82
R7391:Ikbkap UTSW 4 56781212 missense probably benign 0.00
R7403:Ikbkap UTSW 4 56778994 missense probably damaging 1.00
R7432:Ikbkap UTSW 4 56776925 missense probably damaging 1.00
R7674:Ikbkap UTSW 4 56792075 missense probably damaging 0.97
R7736:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R7755:Ikbkap UTSW 4 56774552 missense possibly damaging 0.80
R7760:Ikbkap UTSW 4 56790892 missense probably benign 0.20
R7849:Ikbkap UTSW 4 56758968 missense possibly damaging 0.65
R7932:Ikbkap UTSW 4 56758968 missense possibly damaging 0.65
Z1176:Ikbkap UTSW 4 56790146 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTGGCACTATTCCCAGAGCTC -3'
(R):5'- GCTTCTGATATATTGATGCGTGAC -3'

Sequencing Primer
(F):5'- ATTCCCAGAGCTCCGATCAGTG -3'
(R):5'- CTGGAGCTCACTTTGTAGACCAG -3'
Posted On2019-05-15