Incidental Mutation 'R7129:1700030K09Rik'
ID552524
Institutional Source Beutler Lab
Gene Symbol 1700030K09Rik
Ensembl Gene ENSMUSG00000052794
Gene NameRIKEN cDNA 1700030K09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72443880-72461001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72455355 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 443 (E443G)
Ref Sequence ENSEMBL: ENSMUSP00000063244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064853] [ENSMUST00000121902]
Predicted Effect probably damaging
Transcript: ENSMUST00000064853
AA Change: E443G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063244
Gene: ENSMUSG00000052794
AA Change: E443G

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 421 432 N/A INTRINSIC
Pfam:DUF4614 438 608 2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121902
AA Change: E409G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113279
Gene: ENSMUSG00000052794
AA Change: E409G

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
Pfam:DUF4614 400 575 1.3e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in 1700030K09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:1700030K09Rik APN 8 72455349 missense probably damaging 1.00
IGL01010:1700030K09Rik APN 8 72445215 missense probably damaging 0.98
IGL01449:1700030K09Rik APN 8 72444849 missense probably benign 0.10
IGL01714:1700030K09Rik APN 8 72455569 critical splice donor site probably null
IGL03256:1700030K09Rik APN 8 72445199 missense probably benign 0.01
IGL03275:1700030K09Rik APN 8 72445124 missense probably damaging 1.00
R0417:1700030K09Rik UTSW 8 72445400 missense probably damaging 0.97
R0501:1700030K09Rik UTSW 8 72455372 missense probably benign 0.01
R1444:1700030K09Rik UTSW 8 72451386 missense probably damaging 1.00
R1556:1700030K09Rik UTSW 8 72449633 missense probably damaging 1.00
R2153:1700030K09Rik UTSW 8 72455115 missense probably benign 0.01
R2154:1700030K09Rik UTSW 8 72455115 missense probably benign 0.01
R2298:1700030K09Rik UTSW 8 72455403 missense probably benign 0.08
R3743:1700030K09Rik UTSW 8 72445169 missense probably benign 0.41
R4787:1700030K09Rik UTSW 8 72445164 nonsense probably null
R4860:1700030K09Rik UTSW 8 72455423 missense possibly damaging 0.87
R4860:1700030K09Rik UTSW 8 72455423 missense possibly damaging 0.87
R4994:1700030K09Rik UTSW 8 72455118 missense probably benign 0.02
R5857:1700030K09Rik UTSW 8 72449525 missense probably benign 0.04
R6256:1700030K09Rik UTSW 8 72451428 missense probably damaging 1.00
R7366:1700030K09Rik UTSW 8 72449459 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCACCTACTCGACTGGAAGC -3'
(R):5'- TTGCTCCACTGGTAGGCAAAG -3'

Sequencing Primer
(F):5'- TACTCGACTGGAAGCGCAGATG -3'
(R):5'- GCAGGATCAAGTGTCTGCAC -3'
Posted On2019-05-15