Incidental Mutation 'R0599:Lima1'
ID 55254
Institutional Source Beutler Lab
Gene Symbol Lima1
Ensembl Gene ENSMUSG00000023022
Gene Name LIM domain and actin binding 1
Synonyms 3526402A12Rik, 1110021C24Rik, EPLIN, epithelial protein lost in neoplasm
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99778470-99875456 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99802159 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 146 (N146K)
Ref Sequence ENSEMBL: ENSMUSP00000104652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073691] [ENSMUST00000109024]
AlphaFold Q9ERG0
Predicted Effect probably damaging
Transcript: ENSMUST00000073691
AA Change: N306K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073371
Gene: ENSMUSG00000023022
AA Change: N306K

DomainStartEndE-ValueType
LIM 387 439 5.14e-17 SMART
low complexity region 534 546 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 747 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083709
Predicted Effect probably damaging
Transcript: ENSMUST00000109024
AA Change: N146K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104652
Gene: ENSMUSG00000023022
AA Change: N146K

DomainStartEndE-ValueType
LIM 227 279 5.14e-17 SMART
low complexity region 374 386 N/A INTRINSIC
low complexity region 410 427 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
low complexity region 587 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230033
Meta Mutation Damage Score 0.0949 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that inhibits actin filament depolymerization and cross-links filaments in bundles. It is downregulated in some cancer cell lines. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and expression of some of the variants maybe independently regulated. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Lima1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Lima1 APN 15 99802157 missense possibly damaging 0.47
IGL01104:Lima1 APN 15 99843700 missense probably damaging 1.00
IGL02618:Lima1 APN 15 99802216 splice site probably benign
IGL03124:Lima1 APN 15 99796734 splice site probably benign
R0312:Lima1 UTSW 15 99781087 missense possibly damaging 0.69
R0601:Lima1 UTSW 15 99780472 missense probably damaging 0.98
R1423:Lima1 UTSW 15 99819745 nonsense probably null
R1704:Lima1 UTSW 15 99819736 missense probably benign 0.00
R1784:Lima1 UTSW 15 99780463 missense possibly damaging 0.93
R1819:Lima1 UTSW 15 99819936 missense probably benign 0.01
R1968:Lima1 UTSW 15 99819684 missense probably benign
R2352:Lima1 UTSW 15 99794515 missense probably benign 0.02
R2908:Lima1 UTSW 15 99802110 critical splice donor site probably null
R4582:Lima1 UTSW 15 99780992 missense possibly damaging 0.65
R4672:Lima1 UTSW 15 99843709 missense probably damaging 1.00
R4858:Lima1 UTSW 15 99819576 missense probably benign 0.23
R6140:Lima1 UTSW 15 99781058 missense probably damaging 1.00
R6614:Lima1 UTSW 15 99783580 missense probably damaging 1.00
R6898:Lima1 UTSW 15 99781267 missense possibly damaging 0.61
R7598:Lima1 UTSW 15 99819696 missense probably benign 0.01
R7601:Lima1 UTSW 15 99819696 missense probably benign 0.01
R7878:Lima1 UTSW 15 99819550 missense probably benign 0.12
R8219:Lima1 UTSW 15 99780790 missense probably damaging 1.00
R8348:Lima1 UTSW 15 99780872 missense probably benign 0.00
R8733:Lima1 UTSW 15 99780818 missense probably damaging 1.00
R8821:Lima1 UTSW 15 99806425 missense probably benign 0.00
R9285:Lima1 UTSW 15 99780806 missense probably damaging 1.00
R9300:Lima1 UTSW 15 99806439 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCACCAAATTCCTAGACGCTG -3'
(R):5'- CACAAGCTGTGCTGCTAGAAGAGAG -3'

Sequencing Primer
(F):5'- GCAGCCTAGAGTCAGACTTTC -3'
(R):5'- CTGATGAGCATCCAGTTTGAGAC -3'
Posted On 2013-07-11