Incidental Mutation 'R7129:Cldn16'
ID552544
Institutional Source Beutler Lab
Gene Symbol Cldn16
Ensembl Gene ENSMUSG00000038148
Gene Nameclaudin 16
SynonymsPCLN1, claudin-16, paracellin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location26463135-26482765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26482638 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 232 (D232V)
Ref Sequence ENSEMBL: ENSMUSP00000110957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115302] [ENSMUST00000161053]
Predicted Effect probably damaging
Transcript: ENSMUST00000115302
AA Change: D232V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110957
Gene: ENSMUSG00000038148
AA Change: D232V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 183 2.1e-20 PFAM
Pfam:Claudin_2 14 185 7.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161053
AA Change: D232V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124528
Gene: ENSMUSG00000038148
AA Change: D232V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 183 2.2e-20 PFAM
Pfam:Claudin_2 14 185 1.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is critical for renal paracellular epithelial transport of Ca(2+) and Mg(2+) in the thick ascending loop of Henle. The gene deficiency leads to specific alterations in renal Ca(2+) and Mg(2+) balance and also to disturbances in Na(+) handling. The interaction of this gene and the Cldn 19 gene is required for their assembly into tight junctions and for renal Mg(2+) reabsorption. This gene and the Cldn1 gene are clustered on chromosome 16. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display an age-dependent progressive phenotype that includes hypercalciuria and hypomagnesemia, significantly elevated serum parathyroid hormone and calcitriol (1,25(OH)2D3) levels, and a significantly lower urinary pH but no nephrocalcinosis or renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Cldn16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Cldn16 APN 16 26482546 nonsense probably null
R1469:Cldn16 UTSW 16 26474180 splice site probably benign
R3620:Cldn16 UTSW 16 26477552 missense possibly damaging 0.73
R4586:Cldn16 UTSW 16 26477558 missense probably benign 0.00
R6135:Cldn16 UTSW 16 26474268 missense possibly damaging 0.66
R6257:Cldn16 UTSW 16 26481330 missense probably damaging 0.96
R6818:Cldn16 UTSW 16 26477507 missense probably damaging 1.00
Z1177:Cldn16 UTSW 16 26481250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTTGTCTGTCTTGGAGAAG -3'
(R):5'- TGTGCCATAACCTCCAAAGC -3'

Sequencing Primer
(F):5'- TGGAACTCACGTTGTAGACC -3'
(R):5'- TCAGTGTCAACCTAAAATACAGAGAG -3'
Posted On2019-05-15