Incidental Mutation 'R7129:Kif20a'
ID552548
Institutional Source Beutler Lab
Gene Symbol Kif20a
Ensembl Gene ENSMUSG00000003779
Gene Namekinesin family member 20A
SynonymsRabkinesin-6, Rab6kifl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34624624-34633265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34632535 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 862 (T862A)
Ref Sequence ENSEMBL: ENSMUSP00000132659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025228] [ENSMUST00000133181] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably benign
Transcript: ENSMUST00000025228
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133181
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166044
AA Change: T862A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779
AA Change: T862A

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167161
AA Change: T862A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779
AA Change: T862A

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Meta Mutation Damage Score 0.0574 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Kif20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02448:Kif20a APN 18 34628454 missense possibly damaging 0.49
IGL02654:Kif20a APN 18 34632023 missense probably damaging 1.00
IGL02739:Kif20a APN 18 34628943 nonsense probably null
R0600:Kif20a UTSW 18 34629209 missense probably damaging 1.00
R0748:Kif20a UTSW 18 34628188 splice site probably benign
R0856:Kif20a UTSW 18 34631218 missense probably benign
R1278:Kif20a UTSW 18 34626777 missense probably benign 0.00
R1752:Kif20a UTSW 18 34631581 missense possibly damaging 0.82
R2036:Kif20a UTSW 18 34628462 missense possibly damaging 0.91
R2143:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R2144:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R4231:Kif20a UTSW 18 34632038 missense probably benign
R4372:Kif20a UTSW 18 34629478 missense probably damaging 1.00
R4426:Kif20a UTSW 18 34631941 missense probably damaging 1.00
R4584:Kif20a UTSW 18 34632611 missense probably damaging 1.00
R5524:Kif20a UTSW 18 34630625 critical splice donor site probably null
R5867:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5869:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5949:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5958:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5959:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5967:Kif20a UTSW 18 34630527 missense probably benign 0.10
R5969:Kif20a UTSW 18 34632415 missense probably benign 0.01
R6175:Kif20a UTSW 18 34628146 missense probably damaging 0.98
R6490:Kif20a UTSW 18 34629490 missense possibly damaging 0.84
R6694:Kif20a UTSW 18 34625526 missense probably damaging 0.98
R6866:Kif20a UTSW 18 34628493 missense probably benign 0.10
R7217:Kif20a UTSW 18 34629560 missense probably benign 0.14
R7397:Kif20a UTSW 18 34627676 missense probably damaging 1.00
R7585:Kif20a UTSW 18 34625538 missense probably benign 0.03
X0027:Kif20a UTSW 18 34625530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGCAGAATAACATGGTGC -3'
(R):5'- CTGAATACAGTTCTGGGTGTATGC -3'

Sequencing Primer
(F):5'- TGCTAGTGAAACTGGACCTTCAG -3'
(R):5'- CTGGGTGTATGCTGAAGCTTAAAAG -3'
Posted On2019-05-15