Incidental Mutation 'R0599:Grm4'
ID 55256
Institutional Source Beutler Lab
Gene Symbol Grm4
Ensembl Gene ENSMUSG00000063239
Gene Name glutamate receptor, metabotropic 4
Synonyms mGluR4, Gprc1d
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 27422387-27521403 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27431490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 844 (I844T)
Ref Sequence ENSEMBL: ENSMUSP00000156001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118161] [ENSMUST00000118489] [ENSMUST00000231290] [ENSMUST00000231416] [ENSMUST00000231809] [ENSMUST00000232243]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118161
AA Change: I844T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113819
Gene: ENSMUSG00000063239
AA Change: I844T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 1.4e-110 PFAM
Pfam:Peripla_BP_6 144 486 9e-13 PFAM
Pfam:NCD3G 516 566 2.4e-14 PFAM
Pfam:7tm_3 599 844 7.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118489
SMART Domains Protein: ENSMUSP00000112578
Gene: ENSMUSG00000063239

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 6.2e-104 PFAM
Pfam:Peripla_BP_6 144 486 8.3e-12 PFAM
Pfam:NCD3G 516 566 5.4e-15 PFAM
Pfam:7tm_3 597 817 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231290
AA Change: I844T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000231416
AA Change: I589T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000231809
AA Change: I797T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000232243
Meta Mutation Damage Score 0.3520 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of theis gene results in impaired motor learning, and reduced paired-pulse facilitation and post-tetanic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Grm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Grm4 APN 17 27434737 nonsense probably null
IGL02380:Grm4 APN 17 27434661 missense probably damaging 1.00
IGL03244:Grm4 APN 17 27434823 missense probably damaging 0.99
R0013:Grm4 UTSW 17 27431575 missense probably benign 0.01
R0352:Grm4 UTSW 17 27451891 splice site probably benign
R0616:Grm4 UTSW 17 27434564 missense probably damaging 1.00
R0645:Grm4 UTSW 17 27435209 missense probably damaging 1.00
R0726:Grm4 UTSW 17 27438438 splice site probably benign
R1085:Grm4 UTSW 17 27473033 missense probably damaging 1.00
R1486:Grm4 UTSW 17 27434717 missense probably damaging 1.00
R1535:Grm4 UTSW 17 27434801 missense probably benign 0.01
R1799:Grm4 UTSW 17 27472940 missense probably damaging 0.99
R1914:Grm4 UTSW 17 27434712 missense probably damaging 0.99
R2472:Grm4 UTSW 17 27434675 missense probably damaging 1.00
R3759:Grm4 UTSW 17 27435299 missense probably benign 0.00
R4244:Grm4 UTSW 17 27502735 missense probably damaging 1.00
R5390:Grm4 UTSW 17 27434738 missense probably damaging 1.00
R5476:Grm4 UTSW 17 27434798 missense probably benign 0.04
R5516:Grm4 UTSW 17 27438411 missense probably benign 0.06
R5897:Grm4 UTSW 17 27435163 missense probably benign 0.02
R5956:Grm4 UTSW 17 27435155 missense probably benign 0.01
R6391:Grm4 UTSW 17 27435320 missense probably benign 0.00
R7330:Grm4 UTSW 17 27434824 nonsense probably null
R7449:Grm4 UTSW 17 27435371 missense probably damaging 1.00
R8338:Grm4 UTSW 17 27435003 missense probably damaging 1.00
R8734:Grm4 UTSW 17 27438791 missense probably damaging 1.00
R8899:Grm4 UTSW 17 27434780 missense probably damaging 1.00
R9157:Grm4 UTSW 17 27434982 missense probably benign 0.21
R9203:Grm4 UTSW 17 27435006 missense probably benign 0.04
R9267:Grm4 UTSW 17 27435209 missense possibly damaging 0.86
R9292:Grm4 UTSW 17 27473063 missense probably damaging 1.00
R9344:Grm4 UTSW 17 27434763 missense probably benign 0.09
Z1177:Grm4 UTSW 17 27450194 nonsense probably null
Z1177:Grm4 UTSW 17 27450221 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGTTCTCACACAGCTCTGACTTGG -3'
(R):5'- ACACCTGACACTGTTGACTCTGCC -3'

Sequencing Primer
(F):5'- GACTTGGCTTCCCCATTAGG -3'
(R):5'- ataaggacacaggcacgag -3'
Posted On 2013-07-11