Incidental Mutation 'R7130:Olfr699'
ID552579
Institutional Source Beutler Lab
Gene Symbol Olfr699
Ensembl Gene ENSMUSG00000096714
Gene Nameolfactory receptor 699
SynonymsMOR283-10P, GA_x6K02T2PBJ9-9168355-9167405
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7130 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106787963-106793198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106790182 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 273 (L273P)
Ref Sequence ENSEMBL: ENSMUSP00000150923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065024] [ENSMUST00000215952] [ENSMUST00000216307]
Predicted Effect probably benign
Transcript: ENSMUST00000065024
AA Change: L273P

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068023
Gene: ENSMUSG00000096714
AA Change: L273P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2.1e-5 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215952
AA Change: L273P

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216307
AA Change: L273P

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,902 T735I possibly damaging Het
Adcy10 T A 1: 165,504,047 V83E probably damaging Het
Adcy6 A G 15: 98,597,229 Y701H probably benign Het
Apbb1 G A 7: 105,565,331 H518Y probably damaging Het
Arhgap20 T A 9: 51,849,747 V966E probably damaging Het
Bbx T A 16: 50,210,442 probably null Het
Bpifb9b T A 2: 154,311,672 N219K probably damaging Het
Btbd11 A C 10: 85,387,555 D76A unknown Het
Cdk19 A G 10: 40,479,765 T490A unknown Het
Cyb5r1 T G 1: 134,408,021 probably benign Het
Dnah14 C T 1: 181,745,958 Q2945* probably null Het
Eif5b A G 1: 38,041,776 T733A probably damaging Het
Esyt3 T A 9: 99,318,170 D657V probably benign Het
Fat4 T A 3: 38,980,787 F2863I probably damaging Het
Fbxw14 T A 9: 109,271,282 I435L probably benign Het
Fus G A 7: 127,974,413 G253S unknown Het
Gdi2 T C 13: 3,548,891 V25A probably benign Het
Gm14025 A T 2: 129,039,181 V275D Het
Gm28729 T G 9: 96,519,404 R110S probably benign Het
Gm5286 T C 3: 94,198,527 W51R probably damaging Het
Gm9992 T C 17: 7,370,425 T304A probably benign Het
Gucd1 A G 10: 75,512,117 L28P possibly damaging Het
Hmgxb3 C T 18: 61,132,378 S1176N probably benign Het
Islr2 T C 9: 58,198,292 T606A probably damaging Het
Kcnf1 T C 12: 17,175,809 D137G probably benign Het
Klkb1 T A 8: 45,275,538 T395S probably benign Het
Morc2b T A 17: 33,136,288 S837C possibly damaging Het
Mrpl9 A G 3: 94,447,290 R204G probably benign Het
Naaladl1 A G 19: 6,105,988 E64G probably benign Het
Nlrx1 T C 9: 44,262,341 E521G possibly damaging Het
Npc2 A G 12: 84,765,307 S54P probably damaging Het
Nxpe2 T C 9: 48,339,537 M37V probably benign Het
Olfr1272 T C 2: 90,281,922 I218V probably benign Het
Olfr1412 C T 1: 92,588,912 A194V probably benign Het
Olfr263 T G 13: 21,133,246 V157G probably benign Het
Osbpl9 G A 4: 109,083,099 R213C probably benign Het
Pard3 C A 8: 127,415,683 R907S probably damaging Het
Pcdhb11 A G 18: 37,423,506 S630G probably benign Het
Pcdhb17 G A 18: 37,485,445 C96Y probably damaging Het
Pclo C T 5: 14,679,342 T2738I unknown Het
Pcnx2 G A 8: 125,753,584 R1995* probably null Het
Ppm1a T A 12: 72,784,233 N177K probably benign Het
Rfx6 A T 10: 51,678,380 K106* probably null Het
Rhoh T C 5: 65,892,864 V159A probably damaging Het
Rreb1 T C 13: 37,899,748 V129A probably damaging Het
Sdccag8 C A 1: 176,874,601 A424D probably damaging Het
Sdf2 T C 11: 78,245,997 M1T probably null Het
Sftpb T A 6: 72,305,824 F94I possibly damaging Het
Slc38a2 G T 15: 96,691,382 H410Q probably damaging Het
Slc40a1 A T 1: 45,921,224 V68E probably damaging Het
Srd5a3 T C 5: 76,149,837 V162A possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tango6 A G 8: 106,807,101 D953G probably damaging Het
Tdrd7 T C 4: 46,029,693 S1009P probably damaging Het
Thap3 T C 4: 151,988,916 Y14C possibly damaging Het
Tmem143 T A 7: 45,909,477 M281K possibly damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Tsga10 A G 1: 37,783,884 I516T probably damaging Het
Ttn T C 2: 76,890,669 I6804V unknown Het
Ubtfl1 C A 9: 18,409,847 P224T probably damaging Het
Umad1 G T 6: 8,427,185 C120F probably null Het
Vmn2r79 T C 7: 87,002,266 V291A probably damaging Het
Other mutations in Olfr699
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr699 APN 7 106790589 missense probably benign 0.12
IGL02093:Olfr699 APN 7 106790823 missense probably benign 0.12
IGL02404:Olfr699 APN 7 106790359 missense probably damaging 1.00
IGL03214:Olfr699 APN 7 106790345 missense probably benign
IGL03230:Olfr699 APN 7 106790704 missense probably damaging 1.00
R0194:Olfr699 UTSW 7 106790823 missense probably benign 0.12
R0523:Olfr699 UTSW 7 106790326 missense probably damaging 1.00
R1132:Olfr699 UTSW 7 106790551 missense possibly damaging 0.94
R1373:Olfr699 UTSW 7 106790756 missense probably benign 0.01
R1482:Olfr699 UTSW 7 106790333 missense probably benign 0.00
R1498:Olfr699 UTSW 7 106790416 missense possibly damaging 0.78
R1500:Olfr699 UTSW 7 106790821 missense probably damaging 1.00
R2656:Olfr699 UTSW 7 106790513 missense probably damaging 0.98
R4163:Olfr699 UTSW 7 106790279 missense probably damaging 1.00
R4638:Olfr699 UTSW 7 106790998 start codon destroyed probably null 1.00
R5104:Olfr699 UTSW 7 106790332 missense possibly damaging 0.81
R6216:Olfr699 UTSW 7 106790458 missense probably benign 0.23
R6976:Olfr699 UTSW 7 106790227 missense probably damaging 0.99
R7129:Olfr699 UTSW 7 106790483 missense probably benign 0.00
R8104:Olfr699 UTSW 7 106791130 start gained probably benign
R8104:Olfr699 UTSW 7 106791131 start gained probably benign
Z1177:Olfr699 UTSW 7 106790270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACATATTCTCAGCTTCTCTAG -3'
(R):5'- GGGTGTGGCCTTCCTAATTC -3'

Sequencing Primer
(F):5'- TCTCAGCTTCTCTAGAAAAAGAAAC -3'
(R):5'- ACTTGCTGCCATCCTAGC -3'
Posted On2019-05-15