Incidental Mutation 'R0599:Smarca1'
ID 55260
Institutional Source Beutler Lab
Gene Symbol Smarca1
Ensembl Gene ENSMUSG00000031099
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1
Synonyms 5730494M04Rik, Snf2l
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome X
Chromosomal Location 47809368-47892974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47823426 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 982 (Q982L)
Ref Sequence ENSEMBL: ENSMUSP00000099138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077569] [ENSMUST00000088973] [ENSMUST00000101616]
AlphaFold Q6PGB8
Predicted Effect probably benign
Transcript: ENSMUST00000077569
AA Change: Q982L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076769
Gene: ENSMUSG00000031099
AA Change: Q982L

DomainStartEndE-ValueType
Pfam:DBINO 44 123 2.4e-8 PFAM
low complexity region 154 165 N/A INTRINSIC
DEXDc 183 375 2.08e-42 SMART
Blast:DEXDc 394 429 2e-12 BLAST
HELICc 520 604 7.21e-28 SMART
SANT 848 897 1.92e-6 SMART
SANT 950 1014 1.28e-2 SMART
low complexity region 1015 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088973
AA Change: Q982L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000086366
Gene: ENSMUSG00000031099
AA Change: Q982L

DomainStartEndE-ValueType
Pfam:DBINO 44 123 2.4e-8 PFAM
low complexity region 154 165 N/A INTRINSIC
DEXDc 183 375 2.08e-42 SMART
Blast:DEXDc 394 429 2e-12 BLAST
HELICc 520 604 7.21e-28 SMART
SANT 848 897 1.92e-6 SMART
SANT 950 1014 1.28e-2 SMART
low complexity region 1015 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101616
AA Change: Q982L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099138
Gene: ENSMUSG00000031099
AA Change: Q982L

DomainStartEndE-ValueType
Pfam:DBINO 48 120 2.1e-8 PFAM
low complexity region 154 165 N/A INTRINSIC
DEXDc 183 375 2.08e-42 SMART
Blast:DEXDc 394 429 2e-12 BLAST
HELICc 520 604 7.21e-28 SMART
SANT 848 897 1.92e-6 SMART
SANT 950 1014 1.28e-2 SMART
low complexity region 1015 1037 N/A INTRINSIC
Meta Mutation Damage Score 0.0659 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family of proteins. The encoded protein is an ATPase which is expressed in diverse tissues and contributes to the chromatin remodeling complex that is involved in transcription. The protein may also play a role in DNA damage, growth inhibition and apoptosis of cancer cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Female mice homozygous and male mice hemizygous for a targeted disruption of this gene exhibit abnormalities in neuron differentiation and neuronal precursor proliferation, increased brain and heart weight, and forebrain hypercellularity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Smarca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Smarca1 APN X 47858301 nonsense probably null
IGL01410:Smarca1 APN X 47892378 missense possibly damaging 0.66
IGL02085:Smarca1 APN X 47875232 missense probably damaging 1.00
IGL03342:Smarca1 APN X 47892269 missense probably damaging 0.96
R0972:Smarca1 UTSW X 47849987 missense possibly damaging 0.84
R1902:Smarca1 UTSW X 47849963 nonsense probably null
R1903:Smarca1 UTSW X 47849963 nonsense probably null
R1968:Smarca1 UTSW X 47852687 missense probably damaging 1.00
R2264:Smarca1 UTSW X 47875283 missense probably benign 0.05
R4790:Smarca1 UTSW X 47884067 missense probably null 0.27
X0017:Smarca1 UTSW X 47884088 missense probably null 0.09
Predicted Primers PCR Primer
(F):5'- TGTGTGCCTGTGCAAGCGT -3'
(R):5'- TGCAAGATACAAGGCTCCATTTCATCA -3'

Sequencing Primer
(F):5'- tgtgtgtgtgtgtgtTTTAGC -3'
(R):5'- CAGTTGCGTATTCAGTATGGAACC -3'
Posted On 2013-07-11