Incidental Mutation 'R7130:Morc2b'
ID552609
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7130 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33136288 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 837 (S837C)
Ref Sequence ENSEMBL: ENSMUSP00000056879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053896
AA Change: S837C

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: S837C

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131954
AA Change: S837C

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: S837C

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,902 T735I possibly damaging Het
Adcy10 T A 1: 165,504,047 V83E probably damaging Het
Adcy6 A G 15: 98,597,229 Y701H probably benign Het
Apbb1 G A 7: 105,565,331 H518Y probably damaging Het
Arhgap20 T A 9: 51,849,747 V966E probably damaging Het
Bbx T A 16: 50,210,442 probably null Het
Bpifb9b T A 2: 154,311,672 N219K probably damaging Het
Btbd11 A C 10: 85,387,555 D76A unknown Het
Cdk19 A G 10: 40,479,765 T490A unknown Het
Cyb5r1 T G 1: 134,408,021 probably benign Het
Dnah14 C T 1: 181,745,958 Q2945* probably null Het
Eif5b A G 1: 38,041,776 T733A probably damaging Het
Esyt3 T A 9: 99,318,170 D657V probably benign Het
Fat4 T A 3: 38,980,787 F2863I probably damaging Het
Fbxw14 T A 9: 109,271,282 I435L probably benign Het
Fus G A 7: 127,974,413 G253S unknown Het
Gdi2 T C 13: 3,548,891 V25A probably benign Het
Gm14025 A T 2: 129,039,181 V275D Het
Gm28729 T G 9: 96,519,404 R110S probably benign Het
Gm5286 T C 3: 94,198,527 W51R probably damaging Het
Gm9992 T C 17: 7,370,425 T304A probably benign Het
Gucd1 A G 10: 75,512,117 L28P possibly damaging Het
Hmgxb3 C T 18: 61,132,378 S1176N probably benign Het
Islr2 T C 9: 58,198,292 T606A probably damaging Het
Kcnf1 T C 12: 17,175,809 D137G probably benign Het
Klkb1 T A 8: 45,275,538 T395S probably benign Het
Mrpl9 A G 3: 94,447,290 R204G probably benign Het
Naaladl1 A G 19: 6,105,988 E64G probably benign Het
Nlrx1 T C 9: 44,262,341 E521G possibly damaging Het
Npc2 A G 12: 84,765,307 S54P probably damaging Het
Nxpe2 T C 9: 48,339,537 M37V probably benign Het
Olfr1272 T C 2: 90,281,922 I218V probably benign Het
Olfr1412 C T 1: 92,588,912 A194V probably benign Het
Olfr263 T G 13: 21,133,246 V157G probably benign Het
Olfr699 A G 7: 106,790,182 L273P probably benign Het
Osbpl9 G A 4: 109,083,099 R213C probably benign Het
Pard3 C A 8: 127,415,683 R907S probably damaging Het
Pcdhb11 A G 18: 37,423,506 S630G probably benign Het
Pcdhb17 G A 18: 37,485,445 C96Y probably damaging Het
Pclo C T 5: 14,679,342 T2738I unknown Het
Pcnx2 G A 8: 125,753,584 R1995* probably null Het
Ppm1a T A 12: 72,784,233 N177K probably benign Het
Rfx6 A T 10: 51,678,380 K106* probably null Het
Rhoh T C 5: 65,892,864 V159A probably damaging Het
Rreb1 T C 13: 37,899,748 V129A probably damaging Het
Sdccag8 C A 1: 176,874,601 A424D probably damaging Het
Sdf2 T C 11: 78,245,997 M1T probably null Het
Sftpb T A 6: 72,305,824 F94I possibly damaging Het
Slc38a2 G T 15: 96,691,382 H410Q probably damaging Het
Slc40a1 A T 1: 45,921,224 V68E probably damaging Het
Srd5a3 T C 5: 76,149,837 V162A possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tango6 A G 8: 106,807,101 D953G probably damaging Het
Tdrd7 T C 4: 46,029,693 S1009P probably damaging Het
Thap3 T C 4: 151,988,916 Y14C possibly damaging Het
Tmem143 T A 7: 45,909,477 M281K possibly damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Tsga10 A G 1: 37,783,884 I516T probably damaging Het
Ttn T C 2: 76,890,669 I6804V unknown Het
Ubtfl1 C A 9: 18,409,847 P224T probably damaging Het
Umad1 G T 6: 8,427,185 C120F probably null Het
Vmn2r79 T C 7: 87,002,266 V291A probably damaging Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
R7754:Morc2b UTSW 17 33137244 missense probably benign 0.33
R7756:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7758:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7766:Morc2b UTSW 17 33138423 missense probably benign 0.19
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33137402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTTCCAGAGAATTTGGAC -3'
(R):5'- CCAGTTGACCTCAAGACAGCTC -3'

Sequencing Primer
(F):5'- CCAAGAGGTCAATGGTCTTGTG -3'
(R):5'- GTTGACCTCAAGACAGCTCAGAAAG -3'
Posted On2019-05-15