Mutagenetix > Incidental Mutation

Incidental Mutation 'R7131:Dnah7c'

552615

Institutional Source

Beutler Lab

Gene Symbol

Dnah7c

Ensembl Gene

ENSMUSG00000101337

Gene Name

dynein, axonemal, heavy chain 7C

Synonyms

Dnahc7c

MMRRC Submission

045216-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.405) question?

Stock #

R7131 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46425592-46807476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 46681772 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 2819 (A2819S)

Ref Sequence

ENSEMBL: ENSMUSP00000140430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000189749]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000189749
AA Change: A2819S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: A2819S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	37	48	N/A	INTRINSIC
coiled coil region	714	746	N/A	INTRINSIC
Pfam:DHC_N2	754	1167	2.2e-138	PFAM
AAA	1320	1459	4e-3	SMART
Blast:AAA	1601	1829	4e-87	BLAST
AAA	1968	2116	8.7e-4	SMART
Pfam:AAA_8	2303	2574	6.2e-73	PFAM
Pfam:MT	2586	2935	5.4e-52	PFAM
Pfam:AAA_9	2953	3183	7.4e-63	PFAM
Pfam:Dynein_heavy	3312	4021	1.3e-250	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,548,956	V435A	possibly damaging	Het
Abca13	A	G	11: 9,291,893	N1252S	probably benign	Het
Abcc3	A	T	11: 94,365,031	F543I	probably damaging	Het
Adam15	T	A	3: 89,346,980	Q170L	possibly damaging	Het
AF366264	A	T	8: 13,836,982	W370R	probably damaging	Het
Aldoc	A	G	11: 78,324,456	I19V	possibly damaging	Het
Atrip	T	C	9: 109,060,420	I711M	probably benign	Het
Brwd1	A	C	16: 96,066,498	L149R	probably damaging	Het
Capn9	A	T	8: 124,576,278	D45V	probably damaging	Het
Card9	G	A	2: 26,358,835	R101C	probably damaging	Het
Casc1	A	T	6: 145,177,406	L578Q	probably null	Het
Ccdc36	A	T	9: 108,417,420	D98E	probably benign	Het
Ccdc87	A	G	19: 4,841,757	E759G	probably damaging	Het
Cep250	T	C	2: 155,965,077	M193T	probably damaging	Het
Cfap54	T	C	10: 92,821,104	K3029E	probably benign	Het
Chrna9	G	A	5: 65,977,141	G445D	possibly damaging	Het
Cluap1	C	T	16: 3,940,775	S367L	probably benign	Het
Col5a1	A	G	2: 27,929,486	D200G	unknown	Het
Crhr2	T	C	6: 55,092,127	N388D		Het
Cyp2b23	A	G	7: 26,681,413	L129P	probably benign	Het
Cyr61	T	C	3: 145,648,781	D125G	probably damaging	Het
Dctd	A	G	8: 48,112,040	S67G	probably benign	Het
Dhtkd1	C	G	2: 5,904,070	V738L	probably benign	Het
Dnah17	C	T	11: 118,079,658	D2173N	probably benign	Het
Dot1l	A	G	10: 80,792,341	H1071R	unknown	Het
Doxl2	T	A	6: 48,976,372	Y410*	probably null	Het
Dync2h1	T	A	9: 7,075,786	D3027V	probably damaging	Het
Efl1	A	G	7: 82,658,064	Y56C	probably damaging	Het
Eif4e1b	A	T	13: 54,784,100	R29W	probably null	Het
Evc2	A	G	5: 37,410,258	R860G	probably damaging	Het
Fbxl12	G	A	9: 20,644,383		probably benign	Het
Fibp	T	A	19: 5,461,491	I129N	probably damaging	Het
Folh1	G	T	7: 86,726,112	H555Q	probably damaging	Het
Gcnt4	A	T	13: 96,946,519	T108S	probably damaging	Het
Gm436	A	G	4: 144,670,067	V365A	probably damaging	Het
H1fnt	T	A	15: 98,256,369	K300*	probably null	Het
Hecw2	A	T	1: 53,865,121	V1156E	probably damaging	Het
Herc3	C	G	6: 58,887,424	A681G	probably damaging	Het
Igkv13-84	T	A	6: 68,939,780	C20*	probably null	Het
Ivd	C	A	2: 118,869,774	T94K	probably damaging	Het
Kank2	C	T	9: 21,794,679	A348T	probably benign	Het
Kcnma1	T	C	14: 23,367,494	Y889C	probably damaging	Het
Kif13b	T	C	14: 64,773,068	V1272A	probably damaging	Het
Kmt2d	GCTGCTGCT	GCTGCTGCTCCTGCTGCT	15: 98,849,616		probably benign	Het
Kmt5b	T	A	19: 3,815,412	D825E	probably benign	Het
Krt39	C	T	11: 99,520,871	A130T	probably benign	Het
Krtap4-9	C	T	11: 99,785,457	T68I	unknown	Het
Lmbr1l	A	T	15: 98,906,323	V365E	probably benign	Het
Lonp1	C	T	17: 56,617,814	R531Q	probably damaging	Het
Mecom	T	A	3: 29,980,945	H194L	probably damaging	Het
Mlx	C	T	11: 101,089,242	H188Y	probably damaging	Het
Mrps10	T	C	17: 47,375,015	S77P	probably damaging	Het
Mst1	A	G	9: 108,084,931	E716G	probably null	Het
Mttp	C	T	3: 138,116,132	V210I	probably benign	Het
Mug2	T	C	6: 122,075,247	V988A	probably damaging	Het
Ndufb6	A	G	4: 40,279,336	M1T	probably null	Het
Neurog1	A	T	13: 56,251,750	N61K	probably benign	Het
Nlrp14	A	G	7: 107,184,814	D581G	possibly damaging	Het
Nlrp4a	C	A	7: 26,449,833	N288K	probably benign	Het
Notch3	T	A	17: 32,144,217	H1264L	probably benign	Het
Olfr384	A	T	11: 73,602,736	D52V	possibly damaging	Het
Olfr394	A	T	11: 73,887,954	C139*	probably null	Het
Olfr402	A	G	11: 74,155,780	M209V	probably benign	Het
Patl2	A	T	2: 122,121,782		probably null	Het
Pfkfb4	A	G	9: 109,007,302	T133A	probably benign	Het
Pla2g4f	T	C	2: 120,304,554	E471G	probably null	Het
Postn	T	C	3: 54,362,635	V45A	probably damaging	Het
Ppan	T	A	9: 20,891,154	V257E	possibly damaging	Het
Ptcra	C	G	17: 46,763,596	A7P	probably damaging	Het
Ptprd	C	T	4: 76,066,340	R523H	probably damaging	Het
Pycrl	A	T	15: 75,918,695	I105N	possibly damaging	Het
Rfx1	C	A	8: 84,095,079	Q815K	probably damaging	Het
Rfx3	T	A	19: 27,768,628	K668*	probably null	Het
Ryr2	A	T	13: 11,640,327	D3661E	possibly damaging	Het
Ryr2	A	G	13: 11,668,811		probably null	Het
Sec23ip	T	A	7: 128,779,640	S974T	probably damaging	Het
Setbp1	A	G	18: 79,086,960	F19S	probably benign	Het
Setd1a	AAGCAGCAGCAGCAGCAGCAG	AAGCAGCAGCAGCAGCAG	7: 127,796,418		probably benign	Het
Sh3pxd2b	A	G	11: 32,422,072	K413R	probably damaging	Het
Slc39a12	T	C	2: 14,449,803	V544A	probably damaging	Het
Slc6a7	T	C	18: 61,002,202	Y418C	probably damaging	Het
Snx19	T	G	9: 30,427,893	I109S	probably damaging	Het
Spg20	T	C	3: 55,121,799		probably null	Het
Sptbn2	A	T	19: 4,749,460	Q2097L	probably null	Het
Syne1	T	C	10: 5,228,221	K4751R	probably damaging	Het
Tigit	C	A	16: 43,662,252	G40C	probably damaging	Het
Tmem181a	T	A	17: 6,297,972	I264K	probably damaging	Het
Tom1	T	A	8: 75,057,249	I287N	possibly damaging	Het
Top2a	G	A	11: 99,004,182	P864L	possibly damaging	Het
Trmt44	A	T	5: 35,571,066	V290E	probably damaging	Het
Try4	T	C	6: 41,304,403	I93T	probably benign	Het
Usp24	T	A	4: 106,382,303	H1147Q	possibly damaging	Het
Uspl1	A	T	5: 149,193,935	R109S	probably benign	Het
Vav3	T	A	3: 109,664,346	F755I	probably damaging	Het
Vezt	A	T	10: 93,970,547	Y667*	probably null	Het
Vmn1r231	T	A	17: 20,889,878	L258F	possibly damaging	Het
Zfp207	T	C	11: 80,395,528	M489T	unknown	Het
Zfp462	A	G	4: 55,009,380	T449A	probably benign	Het
Zfp956	C	A	6: 47,955,847	Q19K	probably benign	Het
Zkscan8	A	T	13: 21,525,273	W152R	probably damaging	Het

Other mutations in Dnah7c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Dnah7c	APN	1	46807289	missense	possibly damaging	0.72
IGL02958:Dnah7c	APN	1	46657111	missense	probably damaging	1.00
IGL03035:Dnah7c	APN	1	46524117	missense	probably benign	0.37
IGL03161:Dnah7c	APN	1	46467296	missense	probably benign	0.20
IGL03178:Dnah7c	APN	1	46467365	missense	probably benign
IGL03052:Dnah7c	UTSW	1	46632149	missense	probably damaging	1.00
R0751:Dnah7c	UTSW	1	46465905	missense	probably benign
R1029:Dnah7c	UTSW	1	46612721	missense	probably damaging	1.00
R3104:Dnah7c	UTSW	1	46798279	missense	probably damaging	0.97
R3977:Dnah7c	UTSW	1	46628911	missense	possibly damaging	0.75
R4003:Dnah7c	UTSW	1	46681817	missense	probably damaging	1.00
R4133:Dnah7c	UTSW	1	46665990	missense	probably benign	0.01
R4303:Dnah7c	UTSW	1	46748578	missense	probably damaging	1.00
R4329:Dnah7c	UTSW	1	46649281	missense	probably benign	0.33
R4434:Dnah7c	UTSW	1	46666282	missense	probably damaging	1.00
R4457:Dnah7c	UTSW	1	46740621	missense	probably damaging	1.00
R4470:Dnah7c	UTSW	1	46748635	missense	possibly damaging	0.56
R4507:Dnah7c	UTSW	1	46766611	missense	probably damaging	1.00
R4527:Dnah7c	UTSW	1	46532931	missense	probably benign	0.34
R4571:Dnah7c	UTSW	1	46533216	missense	probably damaging	0.99
R4589:Dnah7c	UTSW	1	46514583	nonsense	probably null
R4731:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4732:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4733:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4747:Dnah7c	UTSW	1	46533168	missense	probably damaging	1.00
R4845:Dnah7c	UTSW	1	46793532	missense	probably damaging	1.00
R4873:Dnah7c	UTSW	1	46688925	missense	probably benign
R4875:Dnah7c	UTSW	1	46688925	missense	probably benign
R4916:Dnah7c	UTSW	1	46595008	missense	probably damaging	1.00
R5241:Dnah7c	UTSW	1	46530500	missense	probably benign
R5279:Dnah7c	UTSW	1	46519269	missense	probably benign	0.14
R5327:Dnah7c	UTSW	1	46665568	missense	probably benign	0.05
R5546:Dnah7c	UTSW	1	46666317	missense	probably damaging	1.00
R5605:Dnah7c	UTSW	1	46798235	missense	possibly damaging	0.84
R5637:Dnah7c	UTSW	1	46760361	splice site	probably null
R5639:Dnah7c	UTSW	1	46739668	missense	probably benign
R5663:Dnah7c	UTSW	1	46535148	missense	probably damaging	1.00
R5718:Dnah7c	UTSW	1	46748666	missense	possibly damaging	0.47
R5759:Dnah7c	UTSW	1	46615367	missense	probably damaging	1.00
R5771:Dnah7c	UTSW	1	46639665	missense	probably benign	0.00
R5784:Dnah7c	UTSW	1	46524068	missense	possibly damaging	0.80
R5800:Dnah7c	UTSW	1	46647015	missense	probably benign	0.01
R5933:Dnah7c	UTSW	1	46519215	missense	probably damaging	1.00
R5948:Dnah7c	UTSW	1	46672497	missense	probably benign	0.21
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6487:Dnah7c	UTSW	1	46769124	missense	probably damaging	1.00
R6536:Dnah7c	UTSW	1	46658290	missense	probably benign	0.00
R6614:Dnah7c	UTSW	1	46649340	missense	probably benign
R6614:Dnah7c	UTSW	1	46649351	missense	probably benign
R6615:Dnah7c	UTSW	1	46515439	missense	probably benign	0.01
R6615:Dnah7c	UTSW	1	46649340	missense	probably benign
R6615:Dnah7c	UTSW	1	46649351	missense	probably benign
R6649:Dnah7c	UTSW	1	46649340	missense	probably benign
R6649:Dnah7c	UTSW	1	46649351	missense	probably benign
R6650:Dnah7c	UTSW	1	46649340	missense	probably benign
R6650:Dnah7c	UTSW	1	46649351	missense	probably benign
R6651:Dnah7c	UTSW	1	46649340	missense	probably benign
R6651:Dnah7c	UTSW	1	46649351	missense	probably benign
R6653:Dnah7c	UTSW	1	46649340	missense	probably benign
R6653:Dnah7c	UTSW	1	46649351	missense	probably benign
R6714:Dnah7c	UTSW	1	46740806	missense	probably damaging	0.99
R6729:Dnah7c	UTSW	1	46672521	missense	possibly damaging	0.46
R6760:Dnah7c	UTSW	1	46649340	missense	probably benign
R6760:Dnah7c	UTSW	1	46649351	missense	probably benign
R6763:Dnah7c	UTSW	1	46628890	missense	possibly damaging	0.60
R6866:Dnah7c	UTSW	1	46657243	missense	probably damaging	1.00
R6880:Dnah7c	UTSW	1	46527671	missense	probably damaging	0.97
R6988:Dnah7c	UTSW	1	46666213	missense	possibly damaging	0.68
R6995:Dnah7c	UTSW	1	46455813	missense	probably benign	0.07
R7007:Dnah7c	UTSW	1	46532750	missense	probably benign	0.04
R7086:Dnah7c	UTSW	1	46750125	missense	probably benign	0.00
R7128:Dnah7c	UTSW	1	46527485	missense	probably benign
R7135:Dnah7c	UTSW	1	46533208	missense	probably damaging	1.00
R7171:Dnah7c	UTSW	1	46680738	missense	probably damaging	0.99
R7176:Dnah7c	UTSW	1	46430809	missense	probably benign	0.00
R7221:Dnah7c	UTSW	1	46455777	missense	possibly damaging	0.87
R7310:Dnah7c	UTSW	1	46596967	missense	possibly damaging	0.94
R7319:Dnah7c	UTSW	1	46780775	missense	probably benign	0.31
R7319:Dnah7c	UTSW	1	46784448	missense	possibly damaging	0.95
R7404:Dnah7c	UTSW	1	46666063	missense	possibly damaging	0.52
R7452:Dnah7c	UTSW	1	46647036	missense	possibly damaging	0.91
R7515:Dnah7c	UTSW	1	46457290	missense	probably benign
R7534:Dnah7c	UTSW	1	46770067	missense	probably damaging	0.98
R7542:Dnah7c	UTSW	1	46784498	missense	probably benign	0.00
R7605:Dnah7c	UTSW	1	46632310	missense	probably damaging	1.00
R7643:Dnah7c	UTSW	1	46602813	missense	probably benign
R7770:Dnah7c	UTSW	1	46626300	splice site	probably null
R7884:Dnah7c	UTSW	1	46791769	missense	probably benign	0.23
R7899:Dnah7c	UTSW	1	46514701	missense	probably benign	0.00
R8025:Dnah7c	UTSW	1	46457296	missense	probably benign	0.01
R8057:Dnah7c	UTSW	1	46688952	missense	possibly damaging	0.52
R8191:Dnah7c	UTSW	1	46607458	missense	possibly damaging	0.56
R8255:Dnah7c	UTSW	1	46659429	missense	probably damaging	1.00
R8428:Dnah7c	UTSW	1	46672376	missense	probably damaging	1.00
R8441:Dnah7c	UTSW	1	46533238	missense	probably damaging	1.00
R8485:Dnah7c	UTSW	1	46680792	missense	probably benign	0.05
R8559:Dnah7c	UTSW	1	46725139	missense	probably damaging	1.00
R8752:Dnah7c	UTSW	1	46672541	missense	probably benign	0.00
R8869:Dnah7c	UTSW	1	46632344	missense	probably damaging	0.97
R9058:Dnah7c	UTSW	1	46766656	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46665490	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46777736	missense	probably benign	0.00
R9246:Dnah7c	UTSW	1	46532774	missense	possibly damaging	0.51
R9319:Dnah7c	UTSW	1	46482008	missense	possibly damaging	0.94
R9388:Dnah7c	UTSW	1	46740726	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46467302	missense	probably benign	0.00
Z1176:Dnah7c	UTSW	1	46615281	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46639665	missense	probably benign
Z1176:Dnah7c	UTSW	1	46646992	critical splice acceptor site	probably null
Z1176:Dnah7c	UTSW	1	46760316	missense	possibly damaging	0.95
Z1177:Dnah7c	UTSW	1	46654103	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CCACAAGTCTTAACCATCAGTTTTC -3'
(R):5'- GGTGATCCCAGTTCACATTTGC -3'

Sequencing Primer
(F):5'- AGTCCTTGCAAAGAGCA -3'
(R):5'- GCAATTGTCAGCACCTACCTGG -3'

Posted On

2019-05-15