Incidental Mutation 'R7131:Dnah7c'
ID 552615
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R7131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 46681772 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 2819 (A2819S)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000189749
AA Change: A2819S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: A2819S

low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,548,956 V435A possibly damaging Het
Abca13 A G 11: 9,291,893 N1252S probably benign Het
Abcc3 A T 11: 94,365,031 F543I probably damaging Het
Adam15 T A 3: 89,346,980 Q170L possibly damaging Het
AF366264 A T 8: 13,836,982 W370R probably damaging Het
Aldoc A G 11: 78,324,456 I19V possibly damaging Het
Atrip T C 9: 109,060,420 I711M probably benign Het
Brwd1 A C 16: 96,066,498 L149R probably damaging Het
Capn9 A T 8: 124,576,278 D45V probably damaging Het
Card9 G A 2: 26,358,835 R101C probably damaging Het
Casc1 A T 6: 145,177,406 L578Q probably null Het
Ccdc36 A T 9: 108,417,420 D98E probably benign Het
Ccdc87 A G 19: 4,841,757 E759G probably damaging Het
Cep250 T C 2: 155,965,077 M193T probably damaging Het
Cfap54 T C 10: 92,821,104 K3029E probably benign Het
Chrna9 G A 5: 65,977,141 G445D possibly damaging Het
Cluap1 C T 16: 3,940,775 S367L probably benign Het
Col5a1 A G 2: 27,929,486 D200G unknown Het
Crhr2 T C 6: 55,092,127 N388D Het
Cyp2b23 A G 7: 26,681,413 L129P probably benign Het
Cyr61 T C 3: 145,648,781 D125G probably damaging Het
Dctd A G 8: 48,112,040 S67G probably benign Het
Dhtkd1 C G 2: 5,904,070 V738L probably benign Het
Dnah17 C T 11: 118,079,658 D2173N probably benign Het
Dot1l A G 10: 80,792,341 H1071R unknown Het
Doxl2 T A 6: 48,976,372 Y410* probably null Het
Dync2h1 T A 9: 7,075,786 D3027V probably damaging Het
Efl1 A G 7: 82,658,064 Y56C probably damaging Het
Eif4e1b A T 13: 54,784,100 R29W probably null Het
Evc2 A G 5: 37,410,258 R860G probably damaging Het
Fbxl12 G A 9: 20,644,383 probably benign Het
Fibp T A 19: 5,461,491 I129N probably damaging Het
Folh1 G T 7: 86,726,112 H555Q probably damaging Het
Gcnt4 A T 13: 96,946,519 T108S probably damaging Het
Gm436 A G 4: 144,670,067 V365A probably damaging Het
H1fnt T A 15: 98,256,369 K300* probably null Het
Hecw2 A T 1: 53,865,121 V1156E probably damaging Het
Herc3 C G 6: 58,887,424 A681G probably damaging Het
Igkv13-84 T A 6: 68,939,780 C20* probably null Het
Ivd C A 2: 118,869,774 T94K probably damaging Het
Kank2 C T 9: 21,794,679 A348T probably benign Het
Kcnma1 T C 14: 23,367,494 Y889C probably damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,849,616 probably benign Het
Kmt5b T A 19: 3,815,412 D825E probably benign Het
Krt39 C T 11: 99,520,871 A130T probably benign Het
Krtap4-9 C T 11: 99,785,457 T68I unknown Het
Lmbr1l A T 15: 98,906,323 V365E probably benign Het
Lonp1 C T 17: 56,617,814 R531Q probably damaging Het
Mecom T A 3: 29,980,945 H194L probably damaging Het
Mlx C T 11: 101,089,242 H188Y probably damaging Het
Mrps10 T C 17: 47,375,015 S77P probably damaging Het
Mst1 A G 9: 108,084,931 E716G probably null Het
Mttp C T 3: 138,116,132 V210I probably benign Het
Mug2 T C 6: 122,075,247 V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 M1T probably null Het
Neurog1 A T 13: 56,251,750 N61K probably benign Het
Nlrp14 A G 7: 107,184,814 D581G possibly damaging Het
Nlrp4a C A 7: 26,449,833 N288K probably benign Het
Notch3 T A 17: 32,144,217 H1264L probably benign Het
Olfr384 A T 11: 73,602,736 D52V possibly damaging Het
Olfr394 A T 11: 73,887,954 C139* probably null Het
Olfr402 A G 11: 74,155,780 M209V probably benign Het
Patl2 A T 2: 122,121,782 probably null Het
Pfkfb4 A G 9: 109,007,302 T133A probably benign Het
Pla2g4f T C 2: 120,304,554 E471G probably null Het
Postn T C 3: 54,362,635 V45A probably damaging Het
Ppan T A 9: 20,891,154 V257E possibly damaging Het
Ptcra C G 17: 46,763,596 A7P probably damaging Het
Ptprd C T 4: 76,066,340 R523H probably damaging Het
Pycrl A T 15: 75,918,695 I105N possibly damaging Het
Rfx1 C A 8: 84,095,079 Q815K probably damaging Het
Rfx3 T A 19: 27,768,628 K668* probably null Het
Ryr2 A G 13: 11,668,811 probably null Het
Ryr2 A T 13: 11,640,327 D3661E possibly damaging Het
Sec23ip T A 7: 128,779,640 S974T probably damaging Het
Setbp1 A G 18: 79,086,960 F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,796,418 probably benign Het
Sh3pxd2b A G 11: 32,422,072 K413R probably damaging Het
Slc39a12 T C 2: 14,449,803 V544A probably damaging Het
Slc6a7 T C 18: 61,002,202 Y418C probably damaging Het
Snx19 T G 9: 30,427,893 I109S probably damaging Het
Spg20 T C 3: 55,121,799 probably null Het
Sptbn2 A T 19: 4,749,460 Q2097L probably null Het
Syne1 T C 10: 5,228,221 K4751R probably damaging Het
Tigit C A 16: 43,662,252 G40C probably damaging Het
Tmem181a T A 17: 6,297,972 I264K probably damaging Het
Tom1 T A 8: 75,057,249 I287N possibly damaging Het
Top2a G A 11: 99,004,182 P864L possibly damaging Het
Trmt44 A T 5: 35,571,066 V290E probably damaging Het
Try4 T C 6: 41,304,403 I93T probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Uspl1 A T 5: 149,193,935 R109S probably benign Het
Vav3 T A 3: 109,664,346 F755I probably damaging Het
Vezt A T 10: 93,970,547 Y667* probably null Het
Vmn1r231 T A 17: 20,889,878 L258F possibly damaging Het
Zfp207 T C 11: 80,395,528 M489T unknown Het
Zfp462 A G 4: 55,009,380 T449A probably benign Het
Zfp956 C A 6: 47,955,847 Q19K probably benign Het
Zkscan8 A T 13: 21,525,273 W152R probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-05-15