Incidental Mutation 'R7131:Card9'
ID 552619
Institutional Source Beutler Lab
Gene Symbol Card9
Ensembl Gene ENSMUSG00000026928
Gene Name caspase recruitment domain family, member 9
Synonyms LOC332579
MMRRC Submission 045216-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26242188-26250930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26248847 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 101 (R101C)
Ref Sequence ENSEMBL: ENSMUSP00000097876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028294] [ENSMUST00000035427] [ENSMUST00000100303] [ENSMUST00000114115]
AlphaFold A2AIV8
Predicted Effect probably damaging
Transcript: ENSMUST00000028294
AA Change: R101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028294
Gene: ENSMUSG00000026928
AA Change: R101C

DomainStartEndE-ValueType
Pfam:CARD 11 97 3.1e-21 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035427
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100303
AA Change: R101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097876
Gene: ENSMUSG00000026928
AA Change: R101C

DomainStartEndE-ValueType
Pfam:CARD 11 97 7.1e-22 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114115
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele of this gene display impaired immune responses to fungal infection but normal rates of bacterial clearance. However, homozygotes for a second allele display impaired bacterial clearance and impaired early innate immune responses. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,637 (GRCm39) V365A probably damaging Het
Abca13 A G 11: 9,241,893 (GRCm39) N1252S probably benign Het
Abcc3 A T 11: 94,255,857 (GRCm39) F543I probably damaging Het
Adam15 T A 3: 89,254,287 (GRCm39) Q170L possibly damaging Het
Aldoc A G 11: 78,215,282 (GRCm39) I19V possibly damaging Het
Aoc1l1 T A 6: 48,953,306 (GRCm39) Y410* probably null Het
Atrip T C 9: 108,889,488 (GRCm39) I711M probably benign Het
Brwd1 A C 16: 95,867,698 (GRCm39) L149R probably damaging Het
Capn9 A T 8: 125,303,017 (GRCm39) D45V probably damaging Het
Ccdc87 A G 19: 4,891,785 (GRCm39) E759G probably damaging Het
Ccn1 T C 3: 145,354,536 (GRCm39) D125G probably damaging Het
Cep250 T C 2: 155,806,997 (GRCm39) M193T probably damaging Het
Cfap54 T C 10: 92,656,966 (GRCm39) K3029E probably benign Het
Chrna9 G A 5: 66,134,484 (GRCm39) G445D possibly damaging Het
Cluap1 C T 16: 3,758,639 (GRCm39) S367L probably benign Het
Col5a1 A G 2: 27,819,498 (GRCm39) D200G unknown Het
Crhr2 T C 6: 55,069,112 (GRCm39) N388D Het
Cyp2b23 A G 7: 26,380,838 (GRCm39) L129P probably benign Het
Dctd A G 8: 48,565,075 (GRCm39) S67G probably benign Het
Dhtkd1 C G 2: 5,908,881 (GRCm39) V738L probably benign Het
Dnah17 C T 11: 117,970,484 (GRCm39) D2173N probably benign Het
Dnah7c G T 1: 46,720,932 (GRCm39) A2819S probably benign Het
Dnai7 A T 6: 145,123,132 (GRCm39) L578Q probably null Het
Dot1l A G 10: 80,628,175 (GRCm39) H1071R unknown Het
Dync2h1 T A 9: 7,075,786 (GRCm39) D3027V probably damaging Het
Efl1 A G 7: 82,307,272 (GRCm39) Y56C probably damaging Het
Eif4e1b A T 13: 54,931,913 (GRCm39) R29W probably null Het
Evc2 A G 5: 37,567,602 (GRCm39) R860G probably damaging Het
Fbxl12 G A 9: 20,555,679 (GRCm39) probably benign Het
Fibp T A 19: 5,511,519 (GRCm39) I129N probably damaging Het
Folh1 G T 7: 86,375,320 (GRCm39) H555Q probably damaging Het
Gcnt4 A T 13: 97,083,027 (GRCm39) T108S probably damaging Het
H1f7 T A 15: 98,154,250 (GRCm39) K300* probably null Het
Hecw2 A T 1: 53,904,280 (GRCm39) V1156E probably damaging Het
Herc3 C G 6: 58,864,409 (GRCm39) A681G probably damaging Het
Igkv13-84 T A 6: 68,916,764 (GRCm39) C20* probably null Het
Iho1 A T 9: 108,294,619 (GRCm39) D98E probably benign Het
Iqca1l A G 5: 24,753,954 (GRCm39) V435A possibly damaging Het
Ivd C A 2: 118,700,255 (GRCm39) T94K probably damaging Het
Kank2 C T 9: 21,705,975 (GRCm39) A348T probably benign Het
Kcnma1 T C 14: 23,417,562 (GRCm39) Y889C probably damaging Het
Kif13b T C 14: 65,010,517 (GRCm39) V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,747,497 (GRCm39) probably benign Het
Kmt5b T A 19: 3,865,412 (GRCm39) D825E probably benign Het
Krt39 C T 11: 99,411,697 (GRCm39) A130T probably benign Het
Krtap4-9 C T 11: 99,676,283 (GRCm39) T68I unknown Het
Lmbr1l A T 15: 98,804,204 (GRCm39) V365E probably benign Het
Lonp1 C T 17: 56,924,814 (GRCm39) R531Q probably damaging Het
Mecom T A 3: 30,035,094 (GRCm39) H194L probably damaging Het
Mlx C T 11: 100,980,068 (GRCm39) H188Y probably damaging Het
Mrps10 T C 17: 47,685,940 (GRCm39) S77P probably damaging Het
Mst1 A G 9: 107,962,130 (GRCm39) E716G probably null Het
Mttp C T 3: 137,821,893 (GRCm39) V210I probably benign Het
Mug2 T C 6: 122,052,206 (GRCm39) V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 (GRCm39) M1T probably null Het
Neurog1 A T 13: 56,399,563 (GRCm39) N61K probably benign Het
Nlrp14 A G 7: 106,784,021 (GRCm39) D581G possibly damaging Het
Nlrp4a C A 7: 26,149,258 (GRCm39) N288K probably benign Het
Notch3 T A 17: 32,363,191 (GRCm39) H1264L probably benign Het
Or1e25 A T 11: 73,493,562 (GRCm39) D52V possibly damaging Het
Or1e34 A T 11: 73,778,780 (GRCm39) C139* probably null Het
Or3a1c A G 11: 74,046,606 (GRCm39) M209V probably benign Het
Patl2 A T 2: 121,952,263 (GRCm39) probably null Het
Pfkfb4 A G 9: 108,836,370 (GRCm39) T133A probably benign Het
Pla2g4f T C 2: 120,135,035 (GRCm39) E471G probably null Het
Postn T C 3: 54,270,056 (GRCm39) V45A probably damaging Het
Ppan T A 9: 20,802,450 (GRCm39) V257E possibly damaging Het
Ptcra C G 17: 47,074,522 (GRCm39) A7P probably damaging Het
Ptprd C T 4: 75,984,577 (GRCm39) R523H probably damaging Het
Pycr3 A T 15: 75,790,544 (GRCm39) I105N possibly damaging Het
Rfx1 C A 8: 84,821,708 (GRCm39) Q815K probably damaging Het
Rfx3 T A 19: 27,746,028 (GRCm39) K668* probably null Het
Ryr2 A T 13: 11,655,213 (GRCm39) D3661E possibly damaging Het
Ryr2 A G 13: 11,683,697 (GRCm39) probably null Het
Sec23ip T A 7: 128,381,364 (GRCm39) S974T probably damaging Het
Semp2l2a A T 8: 13,886,982 (GRCm39) W370R probably damaging Het
Setbp1 A G 18: 79,130,175 (GRCm39) F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,395,590 (GRCm39) probably benign Het
Sh3pxd2b A G 11: 32,372,072 (GRCm39) K413R probably damaging Het
Slc39a12 T C 2: 14,454,614 (GRCm39) V544A probably damaging Het
Slc6a7 T C 18: 61,135,274 (GRCm39) Y418C probably damaging Het
Snx19 T G 9: 30,339,189 (GRCm39) I109S probably damaging Het
Spart T C 3: 55,029,220 (GRCm39) probably null Het
Sptbn2 A T 19: 4,799,488 (GRCm39) Q2097L probably null Het
Syne1 T C 10: 5,178,221 (GRCm39) K4751R probably damaging Het
Tigit C A 16: 43,482,615 (GRCm39) G40C probably damaging Het
Tmem181a T A 17: 6,348,247 (GRCm39) I264K probably damaging Het
Tom1 T A 8: 75,783,877 (GRCm39) I287N possibly damaging Het
Top2a G A 11: 98,895,008 (GRCm39) P864L possibly damaging Het
Trmt44 A T 5: 35,728,410 (GRCm39) V290E probably damaging Het
Try4 T C 6: 41,281,337 (GRCm39) I93T probably benign Het
Usp24 T A 4: 106,239,500 (GRCm39) H1147Q possibly damaging Het
Uspl1 A T 5: 149,130,745 (GRCm39) R109S probably benign Het
Vav3 T A 3: 109,571,662 (GRCm39) F755I probably damaging Het
Vezt A T 10: 93,806,409 (GRCm39) Y667* probably null Het
Vmn1r231 T A 17: 21,110,140 (GRCm39) L258F possibly damaging Het
Zfp207 T C 11: 80,286,354 (GRCm39) M489T unknown Het
Zfp462 A G 4: 55,009,380 (GRCm39) T449A probably benign Het
Zfp956 C A 6: 47,932,781 (GRCm39) Q19K probably benign Het
Zkscan8 A T 13: 21,709,443 (GRCm39) W152R probably damaging Het
Other mutations in Card9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Card9 APN 2 26,246,874 (GRCm39) missense probably benign
IGL02397:Card9 APN 2 26,242,341 (GRCm39) missense probably damaging 1.00
IGL02506:Card9 APN 2 26,244,427 (GRCm39) splice site probably benign
IGL02536:Card9 APN 2 26,248,844 (GRCm39) missense possibly damaging 0.93
IGL02809:Card9 APN 2 26,246,876 (GRCm39) missense probably benign 0.01
IGL02962:Card9 APN 2 26,248,029 (GRCm39) critical splice acceptor site probably null
R1441:Card9 UTSW 2 26,249,402 (GRCm39) missense probably benign 0.01
R1585:Card9 UTSW 2 26,244,398 (GRCm39) missense probably benign 0.01
R1755:Card9 UTSW 2 26,249,546 (GRCm39) missense probably damaging 0.99
R1959:Card9 UTSW 2 26,244,885 (GRCm39) critical splice acceptor site probably null
R2972:Card9 UTSW 2 26,247,222 (GRCm39) missense probably damaging 1.00
R4007:Card9 UTSW 2 26,243,012 (GRCm39) missense possibly damaging 0.95
R4283:Card9 UTSW 2 26,247,309 (GRCm39) missense possibly damaging 0.77
R4789:Card9 UTSW 2 26,247,632 (GRCm39) missense probably damaging 0.99
R5381:Card9 UTSW 2 26,248,895 (GRCm39) missense probably damaging 1.00
R5933:Card9 UTSW 2 26,242,509 (GRCm39) missense probably damaging 1.00
R6379:Card9 UTSW 2 26,246,789 (GRCm39) missense probably damaging 1.00
R7008:Card9 UTSW 2 26,247,811 (GRCm39) missense possibly damaging 0.96
R7124:Card9 UTSW 2 26,246,896 (GRCm39) critical splice acceptor site probably null
R7171:Card9 UTSW 2 26,249,496 (GRCm39) missense possibly damaging 0.78
R7237:Card9 UTSW 2 26,246,787 (GRCm39) missense probably benign 0.00
R7984:Card9 UTSW 2 26,246,784 (GRCm39) missense probably benign 0.00
R8023:Card9 UTSW 2 26,247,327 (GRCm39) missense probably benign 0.00
R8312:Card9 UTSW 2 26,247,801 (GRCm39) nonsense probably null
R8672:Card9 UTSW 2 26,247,950 (GRCm39) missense probably benign 0.30
R9135:Card9 UTSW 2 26,242,397 (GRCm39) missense probably benign 0.00
R9273:Card9 UTSW 2 26,247,310 (GRCm39) missense probably damaging 0.96
R9577:Card9 UTSW 2 26,242,344 (GRCm39) missense probably damaging 1.00
R9626:Card9 UTSW 2 26,247,294 (GRCm39) missense probably benign 0.39
Z1176:Card9 UTSW 2 26,247,808 (GRCm39) missense probably damaging 1.00
Z1177:Card9 UTSW 2 26,247,563 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCAGCAATTCAGGAAGACCC -3'
(R):5'- AGAGCTTGGGATGTCTACCC -3'

Sequencing Primer
(F):5'- GAAGACCCTGCCCCCTAGAG -3'
(R):5'- GGGATGTCTACCCAGAGTAATCATC -3'
Posted On 2019-05-15