Incidental Mutation 'R7131:Col5a1'
Institutional Source Beutler Lab
Gene Symbol Col5a1
Ensembl Gene ENSMUSG00000026837
Gene Namecollagen, type V, alpha 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7131 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location27886425-28039514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27929486 bp
Amino Acid Change Aspartic acid to Glycine at position 200 (D200G)
Ref Sequence ENSEMBL: ENSMUSP00000028280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028280]
Predicted Effect unknown
Transcript: ENSMUST00000028280
AA Change: D200G
SMART Domains Protein: ENSMUSP00000028280
Gene: ENSMUSG00000026837
AA Change: D200G

signal peptide 1 36 N/A INTRINSIC
TSPN 39 230 5.7e-73 SMART
LamG 98 229 6.86e-3 SMART
low complexity region 259 288 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 374 387 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
internal_repeat_7 443 457 9.97e-7 PROSPERO
Pfam:Collagen 467 519 4e-10 PFAM
Pfam:Collagen 557 619 6.5e-9 PFAM
internal_repeat_2 622 642 1.83e-11 PROSPERO
low complexity region 643 698 N/A INTRINSIC
low complexity region 712 757 N/A INTRINSIC
low complexity region 760 793 N/A INTRINSIC
internal_repeat_5 794 817 3.78e-8 PROSPERO
internal_repeat_7 798 812 9.97e-7 PROSPERO
internal_repeat_8 802 821 8.84e-6 PROSPERO
low complexity region 826 862 N/A INTRINSIC
internal_repeat_3 865 889 2.79e-10 PROSPERO
internal_repeat_5 869 892 3.78e-8 PROSPERO
low complexity region 895 925 N/A INTRINSIC
internal_repeat_2 928 948 1.83e-11 PROSPERO
internal_repeat_4 928 948 1.27e-8 PROSPERO
low complexity region 949 979 N/A INTRINSIC
low complexity region 984 1033 N/A INTRINSIC
internal_repeat_4 1039 1062 1.27e-8 PROSPERO
internal_repeat_1 1039 1063 5.12e-15 PROSPERO
internal_repeat_3 1048 1072 2.79e-10 PROSPERO
internal_repeat_6 1049 1072 1.13e-7 PROSPERO
low complexity region 1075 1117 N/A INTRINSIC
low complexity region 1134 1165 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
internal_repeat_8 1195 1214 8.84e-6 PROSPERO
low complexity region 1215 1243 N/A INTRINSIC
low complexity region 1249 1282 N/A INTRINSIC
low complexity region 1285 1421 N/A INTRINSIC
internal_repeat_1 1423 1447 5.12e-15 PROSPERO
Pfam:Collagen 1460 1529 8.4e-9 PFAM
Pfam:Collagen 1513 1575 1.2e-9 PFAM
COLFI 1608 1837 3.33e-153 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10-11 due to cardiovascular insufficiency and lack of collagen fibril formation. Heterozygotes exhibit poorly organized and less dense fibers in the dermis and reduced skin tensile strength and are a model for Ehlers-Danlos Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,548,956 V435A possibly damaging Het
Abca13 A G 11: 9,291,893 N1252S probably benign Het
Abcc3 A T 11: 94,365,031 F543I probably damaging Het
Adam15 T A 3: 89,346,980 Q170L possibly damaging Het
AF366264 A T 8: 13,836,982 W370R probably damaging Het
Aldoc A G 11: 78,324,456 I19V possibly damaging Het
Atrip T C 9: 109,060,420 I711M probably benign Het
Brwd1 A C 16: 96,066,498 L149R probably damaging Het
Capn9 A T 8: 124,576,278 D45V probably damaging Het
Card9 G A 2: 26,358,835 R101C probably damaging Het
Casc1 A T 6: 145,177,406 L578Q probably null Het
Ccdc36 A T 9: 108,417,420 D98E probably benign Het
Ccdc87 A G 19: 4,841,757 E759G probably damaging Het
Cep250 T C 2: 155,965,077 M193T probably damaging Het
Cfap54 T C 10: 92,821,104 K3029E probably benign Het
Chrna9 G A 5: 65,977,141 G445D possibly damaging Het
Cluap1 C T 16: 3,940,775 S367L probably benign Het
Crhr2 T C 6: 55,092,127 N388D Het
Cyp2b23 A G 7: 26,681,413 L129P probably benign Het
Cyr61 T C 3: 145,648,781 D125G probably damaging Het
Dctd A G 8: 48,112,040 S67G probably benign Het
Dhtkd1 C G 2: 5,904,070 V738L probably benign Het
Dnah17 C T 11: 118,079,658 D2173N probably benign Het
Dnah7c G T 1: 46,681,772 A2819S probably benign Het
Dot1l A G 10: 80,792,341 H1071R unknown Het
Doxl2 T A 6: 48,976,372 Y410* probably null Het
Dync2h1 T A 9: 7,075,786 D3027V probably damaging Het
Efl1 A G 7: 82,658,064 Y56C probably damaging Het
Eif4e1b A T 13: 54,784,100 R29W probably null Het
Evc2 A G 5: 37,410,258 R860G probably damaging Het
Fbxl12 G A 9: 20,644,383 probably benign Het
Fibp T A 19: 5,461,491 I129N probably damaging Het
Folh1 G T 7: 86,726,112 H555Q probably damaging Het
Gcnt4 A T 13: 96,946,519 T108S probably damaging Het
Gm436 A G 4: 144,670,067 V365A probably damaging Het
H1fnt T A 15: 98,256,369 K300* probably null Het
Hecw2 A T 1: 53,865,121 V1156E probably damaging Het
Herc3 C G 6: 58,887,424 A681G probably damaging Het
Igkv13-84 T A 6: 68,939,780 C20* probably null Het
Ivd C A 2: 118,869,774 T94K probably damaging Het
Kank2 C T 9: 21,794,679 A348T probably benign Het
Kcnma1 T C 14: 23,367,494 Y889C probably damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,849,616 probably benign Het
Kmt5b T A 19: 3,815,412 D825E probably benign Het
Krt39 C T 11: 99,520,871 A130T probably benign Het
Krtap4-9 C T 11: 99,785,457 T68I unknown Het
Lmbr1l A T 15: 98,906,323 V365E probably benign Het
Lonp1 C T 17: 56,617,814 R531Q probably damaging Het
Mecom T A 3: 29,980,945 H194L probably damaging Het
Mlx C T 11: 101,089,242 H188Y probably damaging Het
Mrps10 T C 17: 47,375,015 S77P probably damaging Het
Mst1 A G 9: 108,084,931 E716G probably null Het
Mttp C T 3: 138,116,132 V210I probably benign Het
Mug2 T C 6: 122,075,247 V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 M1T probably null Het
Neurog1 A T 13: 56,251,750 N61K probably benign Het
Nlrp14 A G 7: 107,184,814 D581G possibly damaging Het
Nlrp4a C A 7: 26,449,833 N288K probably benign Het
Notch3 T A 17: 32,144,217 H1264L probably benign Het
Olfr384 A T 11: 73,602,736 D52V possibly damaging Het
Olfr394 A T 11: 73,887,954 C139* probably null Het
Olfr402 A G 11: 74,155,780 M209V probably benign Het
Patl2 A T 2: 122,121,782 probably null Het
Pfkfb4 A G 9: 109,007,302 T133A probably benign Het
Pla2g4f T C 2: 120,304,554 E471G probably null Het
Postn T C 3: 54,362,635 V45A probably damaging Het
Ppan T A 9: 20,891,154 V257E possibly damaging Het
Ptcra C G 17: 46,763,596 A7P probably damaging Het
Ptprd C T 4: 76,066,340 R523H probably damaging Het
Pycrl A T 15: 75,918,695 I105N possibly damaging Het
Rfx1 C A 8: 84,095,079 Q815K probably damaging Het
Rfx3 T A 19: 27,768,628 K668* probably null Het
Ryr2 A T 13: 11,640,327 D3661E possibly damaging Het
Ryr2 A G 13: 11,668,811 probably null Het
Sec23ip T A 7: 128,779,640 S974T probably damaging Het
Setbp1 A G 18: 79,086,960 F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,796,418 probably benign Het
Sh3pxd2b A G 11: 32,422,072 K413R probably damaging Het
Slc39a12 T C 2: 14,449,803 V544A probably damaging Het
Slc6a7 T C 18: 61,002,202 Y418C probably damaging Het
Snx19 T G 9: 30,427,893 I109S probably damaging Het
Spg20 T C 3: 55,121,799 probably null Het
Sptbn2 A T 19: 4,749,460 Q2097L probably null Het
Syne1 T C 10: 5,228,221 K4751R probably damaging Het
Tigit C A 16: 43,662,252 G40C probably damaging Het
Tmem181a T A 17: 6,297,972 I264K probably damaging Het
Tom1 T A 8: 75,057,249 I287N possibly damaging Het
Top2a G A 11: 99,004,182 P864L possibly damaging Het
Trmt44 A T 5: 35,571,066 V290E probably damaging Het
Try4 T C 6: 41,304,403 I93T probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Uspl1 A T 5: 149,193,935 R109S probably benign Het
Vav3 T A 3: 109,664,346 F755I probably damaging Het
Vezt A T 10: 93,970,547 Y667* probably null Het
Vmn1r231 T A 17: 20,889,878 L258F possibly damaging Het
Zfp207 T C 11: 80,395,528 M489T unknown Het
Zfp462 A G 4: 55,009,380 T449A probably benign Het
Zfp956 C A 6: 47,955,847 Q19K probably benign Het
Zkscan8 A T 13: 21,525,273 W152R probably damaging Het
Other mutations in Col5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Col5a1 APN 2 27971444 splice site probably benign
IGL01340:Col5a1 APN 2 27960451 missense unknown
IGL01938:Col5a1 APN 2 27996873 missense unknown
IGL02167:Col5a1 APN 2 28018556 missense probably benign
IGL02670:Col5a1 APN 2 27974715 missense unknown
IGL02672:Col5a1 APN 2 27974715 missense unknown
IGL02673:Col5a1 APN 2 27974715 missense unknown
IGL02832:Col5a1 APN 2 27952340 missense unknown
IGL03065:Col5a1 APN 2 28032745 missense possibly damaging 0.61
IGL03196:Col5a1 APN 2 27975598 missense unknown
PIT4131001:Col5a1 UTSW 2 28024653 missense probably benign 0.01
PIT4495001:Col5a1 UTSW 2 28024776 missense unknown
R0136:Col5a1 UTSW 2 28024831 missense probably damaging 1.00
R0485:Col5a1 UTSW 2 27990097 splice site probably benign
R0626:Col5a1 UTSW 2 27928243 nonsense probably null
R0666:Col5a1 UTSW 2 28032685 missense probably damaging 1.00
R1268:Col5a1 UTSW 2 28002489 missense unknown
R1302:Col5a1 UTSW 2 28005236 missense probably damaging 1.00
R1416:Col5a1 UTSW 2 27922064 missense unknown
R1466:Col5a1 UTSW 2 28003846 splice site probably benign
R1617:Col5a1 UTSW 2 27952381 missense unknown
R1650:Col5a1 UTSW 2 27922159 missense unknown
R1663:Col5a1 UTSW 2 27951476 missense unknown
R1901:Col5a1 UTSW 2 27960444 missense unknown
R1970:Col5a1 UTSW 2 27986754 missense unknown
R2377:Col5a1 UTSW 2 27928177 missense unknown
R2396:Col5a1 UTSW 2 27986729 missense unknown
R4297:Col5a1 UTSW 2 28017204 critical splice donor site probably null
R4385:Col5a1 UTSW 2 28024779 missense probably damaging 1.00
R4803:Col5a1 UTSW 2 28011341 missense unknown
R4835:Col5a1 UTSW 2 28025644 missense probably damaging 1.00
R4935:Col5a1 UTSW 2 28024742 missense probably damaging 1.00
R4994:Col5a1 UTSW 2 28032739 missense possibly damaging 0.90
R4997:Col5a1 UTSW 2 28032782 nonsense probably null
R5061:Col5a1 UTSW 2 27952378 missense unknown
R5088:Col5a1 UTSW 2 28018602 nonsense probably null
R5089:Col5a1 UTSW 2 28018602 nonsense probably null
R5090:Col5a1 UTSW 2 28018602 nonsense probably null
R5114:Col5a1 UTSW 2 28025652 missense probably damaging 1.00
R5409:Col5a1 UTSW 2 27960445 missense unknown
R5649:Col5a1 UTSW 2 27951456 missense unknown
R5699:Col5a1 UTSW 2 27997599 missense unknown
R5910:Col5a1 UTSW 2 28036888 missense possibly damaging 0.89
R6053:Col5a1 UTSW 2 28014377 unclassified probably benign
R6210:Col5a1 UTSW 2 28032621 missense probably benign 0.04
R6363:Col5a1 UTSW 2 27928195 missense unknown
R6478:Col5a1 UTSW 2 27952436 missense unknown
R6600:Col5a1 UTSW 2 27997571 missense unknown
R7047:Col5a1 UTSW 2 27928084 missense unknown
R7061:Col5a1 UTSW 2 28025678 nonsense probably null
R7202:Col5a1 UTSW 2 27952378 missense unknown
R7270:Col5a1 UTSW 2 27997585 missense unknown
R7385:Col5a1 UTSW 2 28024750 missense unknown
R7492:Col5a1 UTSW 2 27969800 critical splice donor site probably null
R7570:Col5a1 UTSW 2 27951383 missense unknown
R7627:Col5a1 UTSW 2 27950653 nonsense probably null
R8003:Col5a1 UTSW 2 27958328 intron probably benign
R8011:Col5a1 UTSW 2 27980521 splice site probably benign
R8073:Col5a1 UTSW 2 27962129 missense possibly damaging 0.85
R8217:Col5a1 UTSW 2 27922123 missense unknown
Z1176:Col5a1 UTSW 2 28002517 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-15