Incidental Mutation 'R7131:Col5a1'
ID 552620
Institutional Source Beutler Lab
Gene Symbol Col5a1
Ensembl Gene ENSMUSG00000026837
Gene Name collagen, type V, alpha 1
Synonyms
MMRRC Submission 045216-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 27776437-27929526 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27819498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 200 (D200G)
Ref Sequence ENSEMBL: ENSMUSP00000028280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028280]
AlphaFold O88207
Predicted Effect unknown
Transcript: ENSMUST00000028280
AA Change: D200G
SMART Domains Protein: ENSMUSP00000028280
Gene: ENSMUSG00000026837
AA Change: D200G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
TSPN 39 230 5.7e-73 SMART
LamG 98 229 6.86e-3 SMART
low complexity region 259 288 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 374 387 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
internal_repeat_7 443 457 9.97e-7 PROSPERO
Pfam:Collagen 467 519 4e-10 PFAM
Pfam:Collagen 557 619 6.5e-9 PFAM
internal_repeat_2 622 642 1.83e-11 PROSPERO
low complexity region 643 698 N/A INTRINSIC
low complexity region 712 757 N/A INTRINSIC
low complexity region 760 793 N/A INTRINSIC
internal_repeat_5 794 817 3.78e-8 PROSPERO
internal_repeat_7 798 812 9.97e-7 PROSPERO
internal_repeat_8 802 821 8.84e-6 PROSPERO
low complexity region 826 862 N/A INTRINSIC
internal_repeat_3 865 889 2.79e-10 PROSPERO
internal_repeat_5 869 892 3.78e-8 PROSPERO
low complexity region 895 925 N/A INTRINSIC
internal_repeat_2 928 948 1.83e-11 PROSPERO
internal_repeat_4 928 948 1.27e-8 PROSPERO
low complexity region 949 979 N/A INTRINSIC
low complexity region 984 1033 N/A INTRINSIC
internal_repeat_4 1039 1062 1.27e-8 PROSPERO
internal_repeat_1 1039 1063 5.12e-15 PROSPERO
internal_repeat_3 1048 1072 2.79e-10 PROSPERO
internal_repeat_6 1049 1072 1.13e-7 PROSPERO
low complexity region 1075 1117 N/A INTRINSIC
low complexity region 1134 1165 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
internal_repeat_8 1195 1214 8.84e-6 PROSPERO
low complexity region 1215 1243 N/A INTRINSIC
low complexity region 1249 1282 N/A INTRINSIC
low complexity region 1285 1421 N/A INTRINSIC
internal_repeat_1 1423 1447 5.12e-15 PROSPERO
Pfam:Collagen 1460 1529 8.4e-9 PFAM
Pfam:Collagen 1513 1575 1.2e-9 PFAM
COLFI 1608 1837 3.33e-153 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10-11 due to cardiovascular insufficiency and lack of collagen fibril formation. Heterozygotes exhibit poorly organized and less dense fibers in the dermis and reduced skin tensile strength and are a model for Ehlers-Danlos Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,637 (GRCm39) V365A probably damaging Het
Abca13 A G 11: 9,241,893 (GRCm39) N1252S probably benign Het
Abcc3 A T 11: 94,255,857 (GRCm39) F543I probably damaging Het
Adam15 T A 3: 89,254,287 (GRCm39) Q170L possibly damaging Het
Aldoc A G 11: 78,215,282 (GRCm39) I19V possibly damaging Het
Aoc1l1 T A 6: 48,953,306 (GRCm39) Y410* probably null Het
Atrip T C 9: 108,889,488 (GRCm39) I711M probably benign Het
Brwd1 A C 16: 95,867,698 (GRCm39) L149R probably damaging Het
Capn9 A T 8: 125,303,017 (GRCm39) D45V probably damaging Het
Card9 G A 2: 26,248,847 (GRCm39) R101C probably damaging Het
Ccdc87 A G 19: 4,891,785 (GRCm39) E759G probably damaging Het
Ccn1 T C 3: 145,354,536 (GRCm39) D125G probably damaging Het
Cep250 T C 2: 155,806,997 (GRCm39) M193T probably damaging Het
Cfap54 T C 10: 92,656,966 (GRCm39) K3029E probably benign Het
Chrna9 G A 5: 66,134,484 (GRCm39) G445D possibly damaging Het
Cluap1 C T 16: 3,758,639 (GRCm39) S367L probably benign Het
Crhr2 T C 6: 55,069,112 (GRCm39) N388D Het
Cyp2b23 A G 7: 26,380,838 (GRCm39) L129P probably benign Het
Dctd A G 8: 48,565,075 (GRCm39) S67G probably benign Het
Dhtkd1 C G 2: 5,908,881 (GRCm39) V738L probably benign Het
Dnah17 C T 11: 117,970,484 (GRCm39) D2173N probably benign Het
Dnah7c G T 1: 46,720,932 (GRCm39) A2819S probably benign Het
Dnai7 A T 6: 145,123,132 (GRCm39) L578Q probably null Het
Dot1l A G 10: 80,628,175 (GRCm39) H1071R unknown Het
Dync2h1 T A 9: 7,075,786 (GRCm39) D3027V probably damaging Het
Efl1 A G 7: 82,307,272 (GRCm39) Y56C probably damaging Het
Eif4e1b A T 13: 54,931,913 (GRCm39) R29W probably null Het
Evc2 A G 5: 37,567,602 (GRCm39) R860G probably damaging Het
Fbxl12 G A 9: 20,555,679 (GRCm39) probably benign Het
Fibp T A 19: 5,511,519 (GRCm39) I129N probably damaging Het
Folh1 G T 7: 86,375,320 (GRCm39) H555Q probably damaging Het
Gcnt4 A T 13: 97,083,027 (GRCm39) T108S probably damaging Het
H1f7 T A 15: 98,154,250 (GRCm39) K300* probably null Het
Hecw2 A T 1: 53,904,280 (GRCm39) V1156E probably damaging Het
Herc3 C G 6: 58,864,409 (GRCm39) A681G probably damaging Het
Igkv13-84 T A 6: 68,916,764 (GRCm39) C20* probably null Het
Iho1 A T 9: 108,294,619 (GRCm39) D98E probably benign Het
Iqca1l A G 5: 24,753,954 (GRCm39) V435A possibly damaging Het
Ivd C A 2: 118,700,255 (GRCm39) T94K probably damaging Het
Kank2 C T 9: 21,705,975 (GRCm39) A348T probably benign Het
Kcnma1 T C 14: 23,417,562 (GRCm39) Y889C probably damaging Het
Kif13b T C 14: 65,010,517 (GRCm39) V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,747,497 (GRCm39) probably benign Het
Kmt5b T A 19: 3,865,412 (GRCm39) D825E probably benign Het
Krt39 C T 11: 99,411,697 (GRCm39) A130T probably benign Het
Krtap4-9 C T 11: 99,676,283 (GRCm39) T68I unknown Het
Lmbr1l A T 15: 98,804,204 (GRCm39) V365E probably benign Het
Lonp1 C T 17: 56,924,814 (GRCm39) R531Q probably damaging Het
Mecom T A 3: 30,035,094 (GRCm39) H194L probably damaging Het
Mlx C T 11: 100,980,068 (GRCm39) H188Y probably damaging Het
Mrps10 T C 17: 47,685,940 (GRCm39) S77P probably damaging Het
Mst1 A G 9: 107,962,130 (GRCm39) E716G probably null Het
Mttp C T 3: 137,821,893 (GRCm39) V210I probably benign Het
Mug2 T C 6: 122,052,206 (GRCm39) V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 (GRCm39) M1T probably null Het
Neurog1 A T 13: 56,399,563 (GRCm39) N61K probably benign Het
Nlrp14 A G 7: 106,784,021 (GRCm39) D581G possibly damaging Het
Nlrp4a C A 7: 26,149,258 (GRCm39) N288K probably benign Het
Notch3 T A 17: 32,363,191 (GRCm39) H1264L probably benign Het
Or1e25 A T 11: 73,493,562 (GRCm39) D52V possibly damaging Het
Or1e34 A T 11: 73,778,780 (GRCm39) C139* probably null Het
Or3a1c A G 11: 74,046,606 (GRCm39) M209V probably benign Het
Patl2 A T 2: 121,952,263 (GRCm39) probably null Het
Pfkfb4 A G 9: 108,836,370 (GRCm39) T133A probably benign Het
Pla2g4f T C 2: 120,135,035 (GRCm39) E471G probably null Het
Postn T C 3: 54,270,056 (GRCm39) V45A probably damaging Het
Ppan T A 9: 20,802,450 (GRCm39) V257E possibly damaging Het
Ptcra C G 17: 47,074,522 (GRCm39) A7P probably damaging Het
Ptprd C T 4: 75,984,577 (GRCm39) R523H probably damaging Het
Pycr3 A T 15: 75,790,544 (GRCm39) I105N possibly damaging Het
Rfx1 C A 8: 84,821,708 (GRCm39) Q815K probably damaging Het
Rfx3 T A 19: 27,746,028 (GRCm39) K668* probably null Het
Ryr2 A T 13: 11,655,213 (GRCm39) D3661E possibly damaging Het
Ryr2 A G 13: 11,683,697 (GRCm39) probably null Het
Sec23ip T A 7: 128,381,364 (GRCm39) S974T probably damaging Het
Semp2l2a A T 8: 13,886,982 (GRCm39) W370R probably damaging Het
Setbp1 A G 18: 79,130,175 (GRCm39) F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,395,590 (GRCm39) probably benign Het
Sh3pxd2b A G 11: 32,372,072 (GRCm39) K413R probably damaging Het
Slc39a12 T C 2: 14,454,614 (GRCm39) V544A probably damaging Het
Slc6a7 T C 18: 61,135,274 (GRCm39) Y418C probably damaging Het
Snx19 T G 9: 30,339,189 (GRCm39) I109S probably damaging Het
Spart T C 3: 55,029,220 (GRCm39) probably null Het
Sptbn2 A T 19: 4,799,488 (GRCm39) Q2097L probably null Het
Syne1 T C 10: 5,178,221 (GRCm39) K4751R probably damaging Het
Tigit C A 16: 43,482,615 (GRCm39) G40C probably damaging Het
Tmem181a T A 17: 6,348,247 (GRCm39) I264K probably damaging Het
Tom1 T A 8: 75,783,877 (GRCm39) I287N possibly damaging Het
Top2a G A 11: 98,895,008 (GRCm39) P864L possibly damaging Het
Trmt44 A T 5: 35,728,410 (GRCm39) V290E probably damaging Het
Try4 T C 6: 41,281,337 (GRCm39) I93T probably benign Het
Usp24 T A 4: 106,239,500 (GRCm39) H1147Q possibly damaging Het
Uspl1 A T 5: 149,130,745 (GRCm39) R109S probably benign Het
Vav3 T A 3: 109,571,662 (GRCm39) F755I probably damaging Het
Vezt A T 10: 93,806,409 (GRCm39) Y667* probably null Het
Vmn1r231 T A 17: 21,110,140 (GRCm39) L258F possibly damaging Het
Zfp207 T C 11: 80,286,354 (GRCm39) M489T unknown Het
Zfp462 A G 4: 55,009,380 (GRCm39) T449A probably benign Het
Zfp956 C A 6: 47,932,781 (GRCm39) Q19K probably benign Het
Zkscan8 A T 13: 21,709,443 (GRCm39) W152R probably damaging Het
Other mutations in Col5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Col5a1 APN 2 27,861,456 (GRCm39) splice site probably benign
IGL01340:Col5a1 APN 2 27,850,463 (GRCm39) missense unknown
IGL01938:Col5a1 APN 2 27,886,885 (GRCm39) missense unknown
IGL02167:Col5a1 APN 2 27,908,568 (GRCm39) missense probably benign
IGL02670:Col5a1 APN 2 27,864,727 (GRCm39) missense unknown
IGL02672:Col5a1 APN 2 27,864,727 (GRCm39) missense unknown
IGL02673:Col5a1 APN 2 27,864,727 (GRCm39) missense unknown
IGL02832:Col5a1 APN 2 27,842,352 (GRCm39) missense unknown
IGL03065:Col5a1 APN 2 27,922,757 (GRCm39) missense possibly damaging 0.61
IGL03196:Col5a1 APN 2 27,865,610 (GRCm39) missense unknown
PIT4131001:Col5a1 UTSW 2 27,914,665 (GRCm39) missense probably benign 0.01
PIT4495001:Col5a1 UTSW 2 27,914,788 (GRCm39) missense unknown
R0136:Col5a1 UTSW 2 27,914,843 (GRCm39) missense probably damaging 1.00
R0485:Col5a1 UTSW 2 27,880,109 (GRCm39) splice site probably benign
R0626:Col5a1 UTSW 2 27,818,255 (GRCm39) nonsense probably null
R0666:Col5a1 UTSW 2 27,922,697 (GRCm39) missense probably damaging 1.00
R1268:Col5a1 UTSW 2 27,892,501 (GRCm39) missense unknown
R1302:Col5a1 UTSW 2 27,895,248 (GRCm39) missense probably damaging 1.00
R1416:Col5a1 UTSW 2 27,812,076 (GRCm39) missense unknown
R1466:Col5a1 UTSW 2 27,893,858 (GRCm39) splice site probably benign
R1617:Col5a1 UTSW 2 27,842,393 (GRCm39) missense unknown
R1650:Col5a1 UTSW 2 27,812,171 (GRCm39) missense unknown
R1663:Col5a1 UTSW 2 27,841,488 (GRCm39) missense unknown
R1901:Col5a1 UTSW 2 27,850,456 (GRCm39) missense unknown
R1970:Col5a1 UTSW 2 27,876,766 (GRCm39) missense unknown
R2377:Col5a1 UTSW 2 27,818,189 (GRCm39) missense unknown
R2396:Col5a1 UTSW 2 27,876,741 (GRCm39) missense unknown
R4297:Col5a1 UTSW 2 27,907,216 (GRCm39) critical splice donor site probably null
R4385:Col5a1 UTSW 2 27,914,791 (GRCm39) missense probably damaging 1.00
R4803:Col5a1 UTSW 2 27,901,353 (GRCm39) missense unknown
R4835:Col5a1 UTSW 2 27,915,656 (GRCm39) missense probably damaging 1.00
R4935:Col5a1 UTSW 2 27,914,754 (GRCm39) missense probably damaging 1.00
R4994:Col5a1 UTSW 2 27,922,751 (GRCm39) missense possibly damaging 0.90
R4997:Col5a1 UTSW 2 27,922,794 (GRCm39) nonsense probably null
R5061:Col5a1 UTSW 2 27,842,390 (GRCm39) missense unknown
R5088:Col5a1 UTSW 2 27,908,614 (GRCm39) nonsense probably null
R5089:Col5a1 UTSW 2 27,908,614 (GRCm39) nonsense probably null
R5090:Col5a1 UTSW 2 27,908,614 (GRCm39) nonsense probably null
R5114:Col5a1 UTSW 2 27,915,664 (GRCm39) missense probably damaging 1.00
R5409:Col5a1 UTSW 2 27,850,457 (GRCm39) missense unknown
R5649:Col5a1 UTSW 2 27,841,468 (GRCm39) missense unknown
R5699:Col5a1 UTSW 2 27,887,611 (GRCm39) missense unknown
R5910:Col5a1 UTSW 2 27,926,900 (GRCm39) missense possibly damaging 0.89
R6053:Col5a1 UTSW 2 27,904,389 (GRCm39) unclassified probably benign
R6210:Col5a1 UTSW 2 27,922,633 (GRCm39) missense probably benign 0.04
R6363:Col5a1 UTSW 2 27,818,207 (GRCm39) missense unknown
R6478:Col5a1 UTSW 2 27,842,448 (GRCm39) missense unknown
R6600:Col5a1 UTSW 2 27,887,583 (GRCm39) missense unknown
R7047:Col5a1 UTSW 2 27,818,096 (GRCm39) missense unknown
R7061:Col5a1 UTSW 2 27,915,690 (GRCm39) nonsense probably null
R7202:Col5a1 UTSW 2 27,842,390 (GRCm39) missense unknown
R7270:Col5a1 UTSW 2 27,887,597 (GRCm39) missense unknown
R7385:Col5a1 UTSW 2 27,914,762 (GRCm39) missense unknown
R7492:Col5a1 UTSW 2 27,859,812 (GRCm39) critical splice donor site probably null
R7570:Col5a1 UTSW 2 27,841,395 (GRCm39) missense unknown
R7627:Col5a1 UTSW 2 27,840,665 (GRCm39) nonsense probably null
R8003:Col5a1 UTSW 2 27,848,340 (GRCm39) intron probably benign
R8011:Col5a1 UTSW 2 27,870,533 (GRCm39) splice site probably benign
R8073:Col5a1 UTSW 2 27,852,141 (GRCm39) missense possibly damaging 0.85
R8217:Col5a1 UTSW 2 27,812,135 (GRCm39) missense unknown
R8879:Col5a1 UTSW 2 27,904,170 (GRCm39) missense unknown
R8911:Col5a1 UTSW 2 27,887,630 (GRCm39) critical splice donor site probably null
R9082:Col5a1 UTSW 2 27,852,122 (GRCm39) missense possibly damaging 0.73
R9095:Col5a1 UTSW 2 27,914,665 (GRCm39) missense probably benign 0.01
R9170:Col5a1 UTSW 2 27,841,363 (GRCm39) missense unknown
R9264:Col5a1 UTSW 2 27,854,123 (GRCm39) missense unknown
R9265:Col5a1 UTSW 2 27,854,123 (GRCm39) missense unknown
R9461:Col5a1 UTSW 2 27,922,616 (GRCm39) missense unknown
R9596:Col5a1 UTSW 2 27,819,551 (GRCm39) nonsense probably null
R9614:Col5a1 UTSW 2 27,879,186 (GRCm39) missense unknown
R9691:Col5a1 UTSW 2 27,842,994 (GRCm39) missense unknown
R9743:Col5a1 UTSW 2 27,864,505 (GRCm39) missense unknown
Z1176:Col5a1 UTSW 2 27,892,529 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGCTGTGAAGCCACTCTG -3'
(R):5'- AGTCAGGCCGTTCCACTCATAG -3'

Sequencing Primer
(F):5'- ACTCTGGCCTTCTGCAGTGTG -3'
(R):5'- ACTCATAGGTCGTGGCATCC -3'
Posted On 2019-05-15