Incidental Mutation 'R7131:Spart'
ID 552627
Institutional Source Beutler Lab
Gene Symbol Spart
Ensembl Gene ENSMUSG00000036580
Gene Name spartin
Synonyms TAHCCP1, Spg20
MMRRC Submission 045216-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.244) question?
Stock # R7131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 55019529-55044743 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 55029220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000107971] [ENSMUST00000117341] [ENSMUST00000118118] [ENSMUST00000146109] [ENSMUST00000149767]
AlphaFold Q8R1X6
Predicted Effect probably null
Transcript: ENSMUST00000044116
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107971
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117341
SMART Domains Protein: ENSMUSP00000113968
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 582 9.3e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118118
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146109
SMART Domains Protein: ENSMUSP00000121683
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149767
SMART Domains Protein: ENSMUSP00000119719
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 92 6.83e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lipid droplet amintenance, cytokinesis and impaired motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,637 (GRCm39) V365A probably damaging Het
Abca13 A G 11: 9,241,893 (GRCm39) N1252S probably benign Het
Abcc3 A T 11: 94,255,857 (GRCm39) F543I probably damaging Het
Adam15 T A 3: 89,254,287 (GRCm39) Q170L possibly damaging Het
Aldoc A G 11: 78,215,282 (GRCm39) I19V possibly damaging Het
Aoc1l1 T A 6: 48,953,306 (GRCm39) Y410* probably null Het
Atrip T C 9: 108,889,488 (GRCm39) I711M probably benign Het
Brwd1 A C 16: 95,867,698 (GRCm39) L149R probably damaging Het
Capn9 A T 8: 125,303,017 (GRCm39) D45V probably damaging Het
Card9 G A 2: 26,248,847 (GRCm39) R101C probably damaging Het
Ccdc87 A G 19: 4,891,785 (GRCm39) E759G probably damaging Het
Ccn1 T C 3: 145,354,536 (GRCm39) D125G probably damaging Het
Cep250 T C 2: 155,806,997 (GRCm39) M193T probably damaging Het
Cfap54 T C 10: 92,656,966 (GRCm39) K3029E probably benign Het
Chrna9 G A 5: 66,134,484 (GRCm39) G445D possibly damaging Het
Cluap1 C T 16: 3,758,639 (GRCm39) S367L probably benign Het
Col5a1 A G 2: 27,819,498 (GRCm39) D200G unknown Het
Crhr2 T C 6: 55,069,112 (GRCm39) N388D Het
Cyp2b23 A G 7: 26,380,838 (GRCm39) L129P probably benign Het
Dctd A G 8: 48,565,075 (GRCm39) S67G probably benign Het
Dhtkd1 C G 2: 5,908,881 (GRCm39) V738L probably benign Het
Dnah17 C T 11: 117,970,484 (GRCm39) D2173N probably benign Het
Dnah7c G T 1: 46,720,932 (GRCm39) A2819S probably benign Het
Dnai7 A T 6: 145,123,132 (GRCm39) L578Q probably null Het
Dot1l A G 10: 80,628,175 (GRCm39) H1071R unknown Het
Dync2h1 T A 9: 7,075,786 (GRCm39) D3027V probably damaging Het
Efl1 A G 7: 82,307,272 (GRCm39) Y56C probably damaging Het
Eif4e1b A T 13: 54,931,913 (GRCm39) R29W probably null Het
Evc2 A G 5: 37,567,602 (GRCm39) R860G probably damaging Het
Fbxl12 G A 9: 20,555,679 (GRCm39) probably benign Het
Fibp T A 19: 5,511,519 (GRCm39) I129N probably damaging Het
Folh1 G T 7: 86,375,320 (GRCm39) H555Q probably damaging Het
Gcnt4 A T 13: 97,083,027 (GRCm39) T108S probably damaging Het
H1f7 T A 15: 98,154,250 (GRCm39) K300* probably null Het
Hecw2 A T 1: 53,904,280 (GRCm39) V1156E probably damaging Het
Herc3 C G 6: 58,864,409 (GRCm39) A681G probably damaging Het
Igkv13-84 T A 6: 68,916,764 (GRCm39) C20* probably null Het
Iho1 A T 9: 108,294,619 (GRCm39) D98E probably benign Het
Iqca1l A G 5: 24,753,954 (GRCm39) V435A possibly damaging Het
Ivd C A 2: 118,700,255 (GRCm39) T94K probably damaging Het
Kank2 C T 9: 21,705,975 (GRCm39) A348T probably benign Het
Kcnma1 T C 14: 23,417,562 (GRCm39) Y889C probably damaging Het
Kif13b T C 14: 65,010,517 (GRCm39) V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,747,497 (GRCm39) probably benign Het
Kmt5b T A 19: 3,865,412 (GRCm39) D825E probably benign Het
Krt39 C T 11: 99,411,697 (GRCm39) A130T probably benign Het
Krtap4-9 C T 11: 99,676,283 (GRCm39) T68I unknown Het
Lmbr1l A T 15: 98,804,204 (GRCm39) V365E probably benign Het
Lonp1 C T 17: 56,924,814 (GRCm39) R531Q probably damaging Het
Mecom T A 3: 30,035,094 (GRCm39) H194L probably damaging Het
Mlx C T 11: 100,980,068 (GRCm39) H188Y probably damaging Het
Mrps10 T C 17: 47,685,940 (GRCm39) S77P probably damaging Het
Mst1 A G 9: 107,962,130 (GRCm39) E716G probably null Het
Mttp C T 3: 137,821,893 (GRCm39) V210I probably benign Het
Mug2 T C 6: 122,052,206 (GRCm39) V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 (GRCm39) M1T probably null Het
Neurog1 A T 13: 56,399,563 (GRCm39) N61K probably benign Het
Nlrp14 A G 7: 106,784,021 (GRCm39) D581G possibly damaging Het
Nlrp4a C A 7: 26,149,258 (GRCm39) N288K probably benign Het
Notch3 T A 17: 32,363,191 (GRCm39) H1264L probably benign Het
Or1e25 A T 11: 73,493,562 (GRCm39) D52V possibly damaging Het
Or1e34 A T 11: 73,778,780 (GRCm39) C139* probably null Het
Or3a1c A G 11: 74,046,606 (GRCm39) M209V probably benign Het
Patl2 A T 2: 121,952,263 (GRCm39) probably null Het
Pfkfb4 A G 9: 108,836,370 (GRCm39) T133A probably benign Het
Pla2g4f T C 2: 120,135,035 (GRCm39) E471G probably null Het
Postn T C 3: 54,270,056 (GRCm39) V45A probably damaging Het
Ppan T A 9: 20,802,450 (GRCm39) V257E possibly damaging Het
Ptcra C G 17: 47,074,522 (GRCm39) A7P probably damaging Het
Ptprd C T 4: 75,984,577 (GRCm39) R523H probably damaging Het
Pycr3 A T 15: 75,790,544 (GRCm39) I105N possibly damaging Het
Rfx1 C A 8: 84,821,708 (GRCm39) Q815K probably damaging Het
Rfx3 T A 19: 27,746,028 (GRCm39) K668* probably null Het
Ryr2 A T 13: 11,655,213 (GRCm39) D3661E possibly damaging Het
Ryr2 A G 13: 11,683,697 (GRCm39) probably null Het
Sec23ip T A 7: 128,381,364 (GRCm39) S974T probably damaging Het
Semp2l2a A T 8: 13,886,982 (GRCm39) W370R probably damaging Het
Setbp1 A G 18: 79,130,175 (GRCm39) F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,395,590 (GRCm39) probably benign Het
Sh3pxd2b A G 11: 32,372,072 (GRCm39) K413R probably damaging Het
Slc39a12 T C 2: 14,454,614 (GRCm39) V544A probably damaging Het
Slc6a7 T C 18: 61,135,274 (GRCm39) Y418C probably damaging Het
Snx19 T G 9: 30,339,189 (GRCm39) I109S probably damaging Het
Sptbn2 A T 19: 4,799,488 (GRCm39) Q2097L probably null Het
Syne1 T C 10: 5,178,221 (GRCm39) K4751R probably damaging Het
Tigit C A 16: 43,482,615 (GRCm39) G40C probably damaging Het
Tmem181a T A 17: 6,348,247 (GRCm39) I264K probably damaging Het
Tom1 T A 8: 75,783,877 (GRCm39) I287N possibly damaging Het
Top2a G A 11: 98,895,008 (GRCm39) P864L possibly damaging Het
Trmt44 A T 5: 35,728,410 (GRCm39) V290E probably damaging Het
Try4 T C 6: 41,281,337 (GRCm39) I93T probably benign Het
Usp24 T A 4: 106,239,500 (GRCm39) H1147Q possibly damaging Het
Uspl1 A T 5: 149,130,745 (GRCm39) R109S probably benign Het
Vav3 T A 3: 109,571,662 (GRCm39) F755I probably damaging Het
Vezt A T 10: 93,806,409 (GRCm39) Y667* probably null Het
Vmn1r231 T A 17: 21,110,140 (GRCm39) L258F possibly damaging Het
Zfp207 T C 11: 80,286,354 (GRCm39) M489T unknown Het
Zfp462 A G 4: 55,009,380 (GRCm39) T449A probably benign Het
Zfp956 C A 6: 47,932,781 (GRCm39) Q19K probably benign Het
Zkscan8 A T 13: 21,709,443 (GRCm39) W152R probably damaging Het
Other mutations in Spart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Spart APN 3 55,029,177 (GRCm39) missense probably damaging 1.00
IGL01539:Spart APN 3 55,024,723 (GRCm39) missense possibly damaging 0.95
IGL01982:Spart APN 3 55,035,911 (GRCm39) splice site probably null
IGL02345:Spart APN 3 55,025,147 (GRCm39) splice site probably null
IGL03217:Spart APN 3 55,035,912 (GRCm39) splice site probably benign
IGL03344:Spart APN 3 55,029,106 (GRCm39) missense probably benign 0.03
BB007:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
BB017:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
R0145:Spart UTSW 3 55,035,092 (GRCm39) nonsense probably null
R0522:Spart UTSW 3 55,035,786 (GRCm39) missense probably damaging 1.00
R1506:Spart UTSW 3 55,024,992 (GRCm39) missense probably damaging 0.99
R2043:Spart UTSW 3 55,034,969 (GRCm39) missense probably damaging 1.00
R2183:Spart UTSW 3 55,024,554 (GRCm39) missense probably benign 0.43
R4022:Spart UTSW 3 55,025,157 (GRCm39) missense probably damaging 1.00
R5154:Spart UTSW 3 55,024,750 (GRCm39) missense probably damaging 1.00
R5869:Spart UTSW 3 55,042,931 (GRCm39) missense probably benign 0.00
R5987:Spart UTSW 3 55,033,962 (GRCm39) missense probably benign 0.00
R6142:Spart UTSW 3 55,024,669 (GRCm39) missense probably damaging 1.00
R6185:Spart UTSW 3 55,024,640 (GRCm39) missense probably damaging 1.00
R6652:Spart UTSW 3 55,032,248 (GRCm39) missense probably benign 0.00
R6791:Spart UTSW 3 55,034,982 (GRCm39) missense probably damaging 1.00
R7930:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
R8005:Spart UTSW 3 55,024,773 (GRCm39) missense probably benign 0.00
R8458:Spart UTSW 3 55,032,315 (GRCm39) missense probably damaging 1.00
R8734:Spart UTSW 3 55,032,300 (GRCm39) missense possibly damaging 0.92
R8791:Spart UTSW 3 55,029,100 (GRCm39) missense probably benign 0.19
R8929:Spart UTSW 3 55,035,979 (GRCm39) missense possibly damaging 0.96
R9060:Spart UTSW 3 55,032,275 (GRCm39) missense probably benign 0.02
R9172:Spart UTSW 3 55,032,267 (GRCm39) missense possibly damaging 0.68
R9539:Spart UTSW 3 55,034,924 (GRCm39) missense probably damaging 1.00
R9695:Spart UTSW 3 55,033,955 (GRCm39) missense probably benign
RF009:Spart UTSW 3 55,035,027 (GRCm39) missense probably benign 0.00
X0018:Spart UTSW 3 55,042,920 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGTGTGTGACTGGTTATACC -3'
(R):5'- AGGCAGAGCTGGTCAGTAAC -3'

Sequencing Primer
(F):5'- GGTTATACCCTCTAGTTCCTGATAGG -3'
(R):5'- CTGGTCAGTAACAGCTGAGATTAATG -3'
Posted On 2019-05-15