Incidental Mutation 'R0600:Gli2'
ID55263
Institutional Source Beutler Lab
Gene Symbol Gli2
Ensembl Gene ENSMUSG00000048402
Gene NameGLI-Kruppel family member GLI2
Synonyms
MMRRC Submission 038789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0600 (G1)
Quality Score131
Status Validated
Chromosome1
Chromosomal Location118834132-119053619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118840389 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 703 (R703C)
Ref Sequence ENSEMBL: ENSMUSP00000054837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062483]
Predicted Effect probably damaging
Transcript: ENSMUST00000062483
AA Change: R703C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: R703C

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 259 278 N/A INTRINSIC
ZnF_C2H2 417 442 4.98e-1 SMART
ZnF_C2H2 450 477 6.57e0 SMART
ZnF_C2H2 483 507 2.09e-3 SMART
ZnF_C2H2 513 538 4.17e-3 SMART
ZnF_C2H2 544 569 1.84e-4 SMART
low complexity region 637 657 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1428 1435 N/A INTRINSIC
Meta Mutation Damage Score 0.8406 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,357,660 S150P probably damaging Het
4932431P20Rik T A 7: 29,533,265 noncoding transcript Het
5530400C23Rik T G 6: 133,293,211 probably benign Het
Ahctf1 A C 1: 179,763,468 probably null Het
Ang5 T C 14: 43,962,749 V90A probably benign Het
Ano9 C T 7: 141,104,710 G442R probably damaging Het
Apaf1 G A 10: 91,060,052 T386I probably damaging Het
Apob C A 12: 8,006,440 H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 probably benign Het
Asxl1 T A 2: 153,399,904 D791E probably benign Het
Avl9 T C 6: 56,736,906 V383A probably benign Het
Btbd1 A C 7: 81,816,006 D197E probably damaging Het
C87499 A T 4: 88,629,299 I45K probably damaging Het
Camta2 T C 11: 70,673,959 I938V possibly damaging Het
Cdca7 C A 2: 72,483,467 A200D possibly damaging Het
Cep104 A T 4: 154,006,792 Y923F possibly damaging Het
Cep135 G C 5: 76,621,305 V601L probably benign Het
Ces2b G A 8: 104,835,910 G291S probably benign Het
Col6a6 C T 9: 105,761,440 G1400D probably damaging Het
Cyth2 T C 7: 45,813,117 E1G probably damaging Het
Dand5 A T 8: 84,816,292 L185Q probably damaging Het
Dck T C 5: 88,781,221 V253A probably benign Het
Ddx20 A G 3: 105,679,080 S650P probably damaging Het
Dicer1 G A 12: 104,706,864 P799S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eya2 G A 2: 165,769,237 C477Y probably damaging Het
Fam208b A T 13: 3,576,054 F1299I probably benign Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Galntl6 T C 8: 57,837,183 probably null Het
Gda A T 19: 21,434,303 F44I possibly damaging Het
Gm14085 A T 2: 122,514,398 I162F probably damaging Het
Golgb1 T A 16: 36,916,271 L1960Q probably damaging Het
Gramd1b T C 9: 40,308,355 D341G probably damaging Het
Grid2 G T 6: 63,503,435 A78S probably benign Het
Hao2 A T 3: 98,883,560 probably benign Het
Hook3 A G 8: 26,118,986 V10A probably benign Het
Kif20a A G 18: 34,629,209 E425G probably damaging Het
Lrp1 T C 10: 127,567,383 D2107G probably benign Het
Lrriq3 T C 3: 155,187,736 I358T possibly damaging Het
Mad2l2 A G 4: 148,140,924 D17G possibly damaging Het
Mastl G T 2: 23,133,346 T455K probably benign Het
Mkln1 G T 6: 31,432,927 probably benign Het
Mmp1b A T 9: 7,387,947 Y16N possibly damaging Het
Mmp24 C T 2: 155,792,597 A79V probably benign Het
Mrps35 T A 6: 147,070,734 C292S possibly damaging Het
Myom1 T C 17: 71,120,648 F1435L possibly damaging Het
Nars2 C T 7: 97,039,923 H351Y probably damaging Het
Nat2 A T 8: 67,501,267 I10F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm5 A T 7: 104,153,869 Y462* probably null Het
Olfr1228 C A 2: 89,249,398 E87* probably null Het
Olfr1339 C T 4: 118,734,789 H87Y probably damaging Het
Olfr1508 T C 14: 52,463,509 I167V probably benign Het
Olfr322 C A 11: 58,666,160 F200L probably damaging Het
Olfr340 C A 2: 36,452,648 A21E probably benign Het
Olfr44 A T 9: 39,484,988 F85L probably benign Het
Olfr495 T A 7: 108,395,231 I37N probably damaging Het
Olfr855 T C 9: 19,585,304 S256P possibly damaging Het
Olfr926 T A 9: 38,877,815 I213N probably damaging Het
Otog A T 7: 46,251,395 probably benign Het
Pdcd2l A T 7: 34,192,807 D212E possibly damaging Het
Pex5 T C 6: 124,404,637 N213S probably benign Het
Pkn3 C T 2: 30,081,134 P238S probably benign Het
Prl2b1 A T 13: 27,390,740 probably null Het
Ptprb A T 10: 116,368,807 I1849L possibly damaging Het
Rasal3 G T 17: 32,393,526 S787Y probably damaging Het
Scn2a T A 2: 65,701,833 D596E possibly damaging Het
Sdhd A T 9: 50,603,764 V9D possibly damaging Het
Serinc5 T C 13: 92,708,057 S436P probably damaging Het
Slc27a1 C T 8: 71,584,164 P348L probably damaging Het
Smg1 G A 7: 118,160,383 probably benign Het
Sorl1 A T 9: 42,043,900 probably benign Het
Sprtn T A 8: 124,900,218 H112Q probably damaging Het
Tet2 A G 3: 133,467,602 M1633T probably benign Het
Tet2 T A 3: 133,467,725 D1592V probably benign Het
Tmem68 A T 4: 3,569,667 C8S probably damaging Het
Tnrc6a T A 7: 123,171,816 I943N probably benign Het
Trib2 A T 12: 15,794,068 V191D probably damaging Het
Tsc22d4 T C 5: 137,762,655 S113P probably damaging Het
Ttc21b T C 2: 66,239,570 R250G probably damaging Het
Ubr2 T C 17: 46,967,248 Y721C probably damaging Het
Ubtfl1 A T 9: 18,409,364 I63F probably damaging Het
Ush1c G A 7: 46,224,908 P171S probably benign Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vangl1 A G 3: 102,166,937 Y285H probably damaging Het
Virma A G 4: 11,498,769 D70G probably damaging Het
Vmn2r102 T C 17: 19,678,015 F431L probably benign Het
Wdr17 A G 8: 54,661,495 I662T probably damaging Het
Wisp2 G A 2: 163,825,313 C78Y probably damaging Het
Zfp160 G A 17: 21,027,006 R606H probably benign Het
Zfp369 C T 13: 65,296,434 R464C probably damaging Het
Other mutations in Gli2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gli2 APN 1 118836891 missense probably benign
IGL01686:Gli2 APN 1 118848435 missense probably damaging 1.00
IGL01925:Gli2 APN 1 118853376 missense probably damaging 1.00
IGL02106:Gli2 APN 1 118836735 missense probably benign
IGL02202:Gli2 APN 1 118836866 missense probably damaging 0.96
IGL02255:Gli2 APN 1 118844349 critical splice donor site probably null
IGL02437:Gli2 APN 1 118836003 missense probably damaging 1.00
IGL02615:Gli2 APN 1 118844398 missense probably damaging 1.00
IGL02817:Gli2 APN 1 118836371 missense possibly damaging 0.55
IGL03294:Gli2 APN 1 118837436 missense probably benign
fairyfly UTSW 1 118840490 missense possibly damaging 0.93
flea UTSW 1 118835925 missense probably damaging 0.99
patu_digua UTSW 1 118837506 missense probably damaging 1.00
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0164:Gli2 UTSW 1 118890283 intron probably benign
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0308:Gli2 UTSW 1 118842062 missense probably benign 0.00
R0418:Gli2 UTSW 1 118840490 missense possibly damaging 0.93
R0558:Gli2 UTSW 1 118837649 missense probably benign 0.01
R0630:Gli2 UTSW 1 118841918 missense possibly damaging 0.52
R0690:Gli2 UTSW 1 118844460 missense probably damaging 1.00
R0942:Gli2 UTSW 1 118837506 missense probably damaging 1.00
R1061:Gli2 UTSW 1 118854517 missense possibly damaging 0.71
R1104:Gli2 UTSW 1 118853350 missense probably damaging 1.00
R1141:Gli2 UTSW 1 118837937 missense possibly damaging 0.71
R1344:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1418:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1565:Gli2 UTSW 1 118841930 missense possibly damaging 0.57
R1605:Gli2 UTSW 1 118854560 missense probably damaging 1.00
R1640:Gli2 UTSW 1 118836524 missense possibly damaging 0.83
R1728:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1728:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1729:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1729:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1730:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1730:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1739:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1739:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1762:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1762:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1783:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1783:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1785:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1785:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1874:Gli2 UTSW 1 119002049 missense possibly damaging 0.83
R1969:Gli2 UTSW 1 118837700 missense probably benign 0.00
R2199:Gli2 UTSW 1 118837648 missense possibly damaging 0.95
R2377:Gli2 UTSW 1 118837125 missense possibly damaging 0.90
R2883:Gli2 UTSW 1 118868144 missense probably damaging 0.97
R2924:Gli2 UTSW 1 118836359 missense probably benign 0.00
R4363:Gli2 UTSW 1 118853370 missense probably benign 0.00
R4430:Gli2 UTSW 1 118837244 missense probably benign
R4463:Gli2 UTSW 1 118836008 missense probably damaging 1.00
R4583:Gli2 UTSW 1 118842068 missense probably benign
R4613:Gli2 UTSW 1 118837511 missense probably damaging 1.00
R4674:Gli2 UTSW 1 118836029 missense probably damaging 1.00
R4735:Gli2 UTSW 1 118840322 missense probably damaging 1.00
R4770:Gli2 UTSW 1 118982588 intron probably benign
R4936:Gli2 UTSW 1 118836140 missense probably benign
R5137:Gli2 UTSW 1 118855503 missense probably damaging 1.00
R5228:Gli2 UTSW 1 118836206 missense probably damaging 1.00
R5318:Gli2 UTSW 1 118844470 missense probably damaging 1.00
R5619:Gli2 UTSW 1 118836755 missense probably benign 0.27
R5661:Gli2 UTSW 1 118853302 nonsense probably null
R6005:Gli2 UTSW 1 118842064 missense probably damaging 1.00
R6012:Gli2 UTSW 1 118837715 missense probably damaging 0.99
R6341:Gli2 UTSW 1 118836224 missense probably damaging 1.00
R6357:Gli2 UTSW 1 118841959 missense probably damaging 1.00
R6425:Gli2 UTSW 1 118835894 nonsense probably null
R6513:Gli2 UTSW 1 118855554 missense probably damaging 1.00
R6802:Gli2 UTSW 1 118842065 missense probably damaging 1.00
R6889:Gli2 UTSW 1 118844416 missense probably damaging 1.00
R7259:Gli2 UTSW 1 118836534 missense probably benign
R7378:Gli2 UTSW 1 118848492 missense probably damaging 1.00
R7420:Gli2 UTSW 1 118835939 missense probably benign 0.00
R7489:Gli2 UTSW 1 118838175 missense probably benign 0.00
R7498:Gli2 UTSW 1 118835835 missense possibly damaging 0.89
X0028:Gli2 UTSW 1 118837277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTCACTCACCATTGACTGGAAG -3'
(R):5'- GCCCAAGCATACAGAGCATGGTAG -3'

Sequencing Primer
(F):5'- CACCATTGACTGGAAGGGGAG -3'
(R):5'- ACAGGACTGGGTGACTTCTC -3'
Posted On2013-07-11