Mutagenetix > Incidental Mutation

Incidental Mutation 'R7131:Usp24'

552635

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

045216-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7131 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106382303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1147 (H1147Q)

Ref Sequence

ENSEMBL: ENSMUSP00000092538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094933
AA Change: H1147Q

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: H1147Q

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165709
AA Change: H1148Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: H1148Q

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,548,956	V435A	possibly damaging	Het
Abca13	A	G	11: 9,291,893	N1252S	probably benign	Het
Abcc3	A	T	11: 94,365,031	F543I	probably damaging	Het
Adam15	T	A	3: 89,346,980	Q170L	possibly damaging	Het
AF366264	A	T	8: 13,836,982	W370R	probably damaging	Het
Aldoc	A	G	11: 78,324,456	I19V	possibly damaging	Het
Atrip	T	C	9: 109,060,420	I711M	probably benign	Het
Brwd1	A	C	16: 96,066,498	L149R	probably damaging	Het
Capn9	A	T	8: 124,576,278	D45V	probably damaging	Het
Card9	G	A	2: 26,358,835	R101C	probably damaging	Het
Casc1	A	T	6: 145,177,406	L578Q	probably null	Het
Ccdc36	A	T	9: 108,417,420	D98E	probably benign	Het
Ccdc87	A	G	19: 4,841,757	E759G	probably damaging	Het
Cep250	T	C	2: 155,965,077	M193T	probably damaging	Het
Cfap54	T	C	10: 92,821,104	K3029E	probably benign	Het
Chrna9	G	A	5: 65,977,141	G445D	possibly damaging	Het
Cluap1	C	T	16: 3,940,775	S367L	probably benign	Het
Col5a1	A	G	2: 27,929,486	D200G	unknown	Het
Crhr2	T	C	6: 55,092,127	N388D		Het
Cyp2b23	A	G	7: 26,681,413	L129P	probably benign	Het
Cyr61	T	C	3: 145,648,781	D125G	probably damaging	Het
Dctd	A	G	8: 48,112,040	S67G	probably benign	Het
Dhtkd1	C	G	2: 5,904,070	V738L	probably benign	Het
Dnah17	C	T	11: 118,079,658	D2173N	probably benign	Het
Dnah7c	G	T	1: 46,681,772	A2819S	probably benign	Het
Dot1l	A	G	10: 80,792,341	H1071R	unknown	Het
Doxl2	T	A	6: 48,976,372	Y410*	probably null	Het
Dync2h1	T	A	9: 7,075,786	D3027V	probably damaging	Het
Efl1	A	G	7: 82,658,064	Y56C	probably damaging	Het
Eif4e1b	A	T	13: 54,784,100	R29W	probably null	Het
Evc2	A	G	5: 37,410,258	R860G	probably damaging	Het
Fbxl12	G	A	9: 20,644,383		probably benign	Het
Fibp	T	A	19: 5,461,491	I129N	probably damaging	Het
Folh1	G	T	7: 86,726,112	H555Q	probably damaging	Het
Gcnt4	A	T	13: 96,946,519	T108S	probably damaging	Het
Gm436	A	G	4: 144,670,067	V365A	probably damaging	Het
H1fnt	T	A	15: 98,256,369	K300*	probably null	Het
Hecw2	A	T	1: 53,865,121	V1156E	probably damaging	Het
Herc3	C	G	6: 58,887,424	A681G	probably damaging	Het
Igkv13-84	T	A	6: 68,939,780	C20*	probably null	Het
Ivd	C	A	2: 118,869,774	T94K	probably damaging	Het
Kank2	C	T	9: 21,794,679	A348T	probably benign	Het
Kcnma1	T	C	14: 23,367,494	Y889C	probably damaging	Het
Kif13b	T	C	14: 64,773,068	V1272A	probably damaging	Het
Kmt2d	GCTGCTGCT	GCTGCTGCTCCTGCTGCT	15: 98,849,616		probably benign	Het
Kmt5b	T	A	19: 3,815,412	D825E	probably benign	Het
Krt39	C	T	11: 99,520,871	A130T	probably benign	Het
Krtap4-9	C	T	11: 99,785,457	T68I	unknown	Het
Lmbr1l	A	T	15: 98,906,323	V365E	probably benign	Het
Lonp1	C	T	17: 56,617,814	R531Q	probably damaging	Het
Mecom	T	A	3: 29,980,945	H194L	probably damaging	Het
Mlx	C	T	11: 101,089,242	H188Y	probably damaging	Het
Mrps10	T	C	17: 47,375,015	S77P	probably damaging	Het
Mst1	A	G	9: 108,084,931	E716G	probably null	Het
Mttp	C	T	3: 138,116,132	V210I	probably benign	Het
Mug2	T	C	6: 122,075,247	V988A	probably damaging	Het
Ndufb6	A	G	4: 40,279,336	M1T	probably null	Het
Neurog1	A	T	13: 56,251,750	N61K	probably benign	Het
Nlrp14	A	G	7: 107,184,814	D581G	possibly damaging	Het
Nlrp4a	C	A	7: 26,449,833	N288K	probably benign	Het
Notch3	T	A	17: 32,144,217	H1264L	probably benign	Het
Olfr384	A	T	11: 73,602,736	D52V	possibly damaging	Het
Olfr394	A	T	11: 73,887,954	C139*	probably null	Het
Olfr402	A	G	11: 74,155,780	M209V	probably benign	Het
Patl2	A	T	2: 122,121,782		probably null	Het
Pfkfb4	A	G	9: 109,007,302	T133A	probably benign	Het
Pla2g4f	T	C	2: 120,304,554	E471G	probably null	Het
Postn	T	C	3: 54,362,635	V45A	probably damaging	Het
Ppan	T	A	9: 20,891,154	V257E	possibly damaging	Het
Ptcra	C	G	17: 46,763,596	A7P	probably damaging	Het
Ptprd	C	T	4: 76,066,340	R523H	probably damaging	Het
Pycrl	A	T	15: 75,918,695	I105N	possibly damaging	Het
Rfx1	C	A	8: 84,095,079	Q815K	probably damaging	Het
Rfx3	T	A	19: 27,768,628	K668*	probably null	Het
Ryr2	A	G	13: 11,668,811		probably null	Het
Ryr2	A	T	13: 11,640,327	D3661E	possibly damaging	Het
Sec23ip	T	A	7: 128,779,640	S974T	probably damaging	Het
Setbp1	A	G	18: 79,086,960	F19S	probably benign	Het
Setd1a	AAGCAGCAGCAGCAGCAGCAG	AAGCAGCAGCAGCAGCAG	7: 127,796,418		probably benign	Het
Sh3pxd2b	A	G	11: 32,422,072	K413R	probably damaging	Het
Slc39a12	T	C	2: 14,449,803	V544A	probably damaging	Het
Slc6a7	T	C	18: 61,002,202	Y418C	probably damaging	Het
Snx19	T	G	9: 30,427,893	I109S	probably damaging	Het
Spg20	T	C	3: 55,121,799		probably null	Het
Sptbn2	A	T	19: 4,749,460	Q2097L	probably null	Het
Syne1	T	C	10: 5,228,221	K4751R	probably damaging	Het
Tigit	C	A	16: 43,662,252	G40C	probably damaging	Het
Tmem181a	T	A	17: 6,297,972	I264K	probably damaging	Het
Tom1	T	A	8: 75,057,249	I287N	possibly damaging	Het
Top2a	G	A	11: 99,004,182	P864L	possibly damaging	Het
Trmt44	A	T	5: 35,571,066	V290E	probably damaging	Het
Try4	T	C	6: 41,304,403	I93T	probably benign	Het
Uspl1	A	T	5: 149,193,935	R109S	probably benign	Het
Vav3	T	A	3: 109,664,346	F755I	probably damaging	Het
Vezt	A	T	10: 93,970,547	Y667*	probably null	Het
Vmn1r231	T	A	17: 20,889,878	L258F	possibly damaging	Het
Zfp207	T	C	11: 80,395,528	M489T	unknown	Het
Zfp462	A	G	4: 55,009,380	T449A	probably benign	Het
Zfp956	C	A	6: 47,955,847	Q19K	probably benign	Het
Zkscan8	A	T	13: 21,525,273	W152R	probably damaging	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9653:Usp24	UTSW	4	106347367	missense	probably benign	0.03
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- AGGTCTTATGAGTCTCCCCG -3'
(R):5'- ATTTTCTGGCAGATCAGTCCCATAG -3'

Sequencing Primer
(F):5'- TATGAGTCTCCCCGCCCCC -3'
(R):5'- GTCCCATAGTAAAACCTGTCACTTG -3'

Posted On

2019-05-15