Incidental Mutation 'R0600:Pkn3'
ID 55266
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Name protein kinase N3
Synonyms
MMRRC Submission 038789-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0600 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 29967696-29981034 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 29971146 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 238 (P238S)
Ref Sequence ENSEMBL: ENSMUSP00000041025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000125346] [ENSMUST00000150770]
AlphaFold Q8K045
Predicted Effect probably benign
Transcript: ENSMUST00000045246
AA Change: P238S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785
AA Change: P238S

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125346
SMART Domains Protein: ENSMUSP00000120268
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 19 82 3.45e-17 SMART
Hr1 102 170 6.19e-19 SMART
Hr1 175 238 6.4e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148650
Predicted Effect probably benign
Transcript: ENSMUST00000150770
SMART Domains Protein: ENSMUSP00000114492
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 28 91 3.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156197
Meta Mutation Damage Score 0.0853 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 130,959,389 (GRCm39) S150P probably damaging Het
5530400C23Rik T G 6: 133,270,174 (GRCm39) probably benign Het
Ahctf1 A C 1: 179,591,033 (GRCm39) probably null Het
Ang5 T C 14: 44,200,206 (GRCm39) V90A probably benign Het
Ano9 C T 7: 140,684,623 (GRCm39) G442R probably damaging Het
Apaf1 G A 10: 90,895,914 (GRCm39) T386I probably damaging Het
Apob C A 12: 8,056,440 (GRCm39) H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 (GRCm39) probably benign Het
Asxl1 T A 2: 153,241,824 (GRCm39) D791E probably benign Het
Avl9 T C 6: 56,713,891 (GRCm39) V383A probably benign Het
Btbd1 A C 7: 81,465,754 (GRCm39) D197E probably damaging Het
Camta2 T C 11: 70,564,785 (GRCm39) I938V possibly damaging Het
Ccn5 G A 2: 163,667,233 (GRCm39) C78Y probably damaging Het
Cdca7 C A 2: 72,313,811 (GRCm39) A200D possibly damaging Het
Cep104 A T 4: 154,091,249 (GRCm39) Y923F possibly damaging Het
Cep135 G C 5: 76,769,152 (GRCm39) V601L probably benign Het
Ces2b G A 8: 105,562,542 (GRCm39) G291S probably benign Het
Col6a6 C T 9: 105,638,639 (GRCm39) G1400D probably damaging Het
Cyth2 T C 7: 45,462,541 (GRCm39) E1G probably damaging Het
Dand5 A T 8: 85,542,921 (GRCm39) L185Q probably damaging Het
Dck T C 5: 88,929,080 (GRCm39) V253A probably benign Het
Ddx20 A G 3: 105,586,396 (GRCm39) S650P probably damaging Het
Dicer1 G A 12: 104,673,123 (GRCm39) P799S probably damaging Het
Dst C T 1: 34,228,200 (GRCm39) P1606L probably damaging Het
Eya2 G A 2: 165,611,157 (GRCm39) C477Y probably damaging Het
Fip1l1 T A 5: 74,756,503 (GRCm39) N498K probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Galntl6 T C 8: 58,290,217 (GRCm39) probably null Het
Gda A T 19: 21,411,667 (GRCm39) F44I possibly damaging Het
Gli2 G A 1: 118,768,119 (GRCm39) R703C probably damaging Het
Golgb1 T A 16: 36,736,633 (GRCm39) L1960Q probably damaging Het
Gramd1b T C 9: 40,219,651 (GRCm39) D341G probably damaging Het
Grid2 G T 6: 63,480,419 (GRCm39) A78S probably benign Het
Hao2 A T 3: 98,790,876 (GRCm39) probably benign Het
Hook3 A G 8: 26,609,014 (GRCm39) V10A probably benign Het
Kif20a A G 18: 34,762,262 (GRCm39) E425G probably damaging Het
Lrp1 T C 10: 127,403,252 (GRCm39) D2107G probably benign Het
Lrriq3 T C 3: 154,893,373 (GRCm39) I358T possibly damaging Het
Mad2l2 A G 4: 148,225,381 (GRCm39) D17G possibly damaging Het
Mastl G T 2: 23,023,358 (GRCm39) T455K probably benign Het
Mkln1 G T 6: 31,409,862 (GRCm39) probably benign Het
Mmp1b A T 9: 7,387,947 (GRCm39) Y16N possibly damaging Het
Mmp24 C T 2: 155,634,517 (GRCm39) A79V probably benign Het
Mrps35 T A 6: 146,972,232 (GRCm39) C292S possibly damaging Het
Myom1 T C 17: 71,427,643 (GRCm39) F1435L possibly damaging Het
Nars2 C T 7: 96,689,130 (GRCm39) H351Y probably damaging Het
Nat2 A T 8: 67,953,919 (GRCm39) I10F probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm5 A T 7: 103,803,076 (GRCm39) Y462* probably null Het
Or13p5 C T 4: 118,591,986 (GRCm39) H87Y probably damaging Het
Or1j12 C A 2: 36,342,660 (GRCm39) A21E probably benign Het
Or2w3 C A 11: 58,556,986 (GRCm39) F200L probably damaging Het
Or4c122 C A 2: 89,079,742 (GRCm39) E87* probably null Het
Or4e1 T C 14: 52,700,966 (GRCm39) I167V probably benign Het
Or5p70 T A 7: 107,994,438 (GRCm39) I37N probably damaging Het
Or7g35 T C 9: 19,496,600 (GRCm39) S256P possibly damaging Het
Or8d2b T A 9: 38,789,111 (GRCm39) I213N probably damaging Het
Or8g20 A T 9: 39,396,284 (GRCm39) F85L probably benign Het
Otog A T 7: 45,900,819 (GRCm39) probably benign Het
Pdcd2l A T 7: 33,892,232 (GRCm39) D212E possibly damaging Het
Pex5 T C 6: 124,381,596 (GRCm39) N213S probably benign Het
Pramel32 A T 4: 88,547,536 (GRCm39) I45K probably damaging Het
Prl2b1 A T 13: 27,574,723 (GRCm39) probably null Het
Ptprb A T 10: 116,204,712 (GRCm39) I1849L possibly damaging Het
Rasal3 G T 17: 32,612,500 (GRCm39) S787Y probably damaging Het
Scn2a T A 2: 65,532,177 (GRCm39) D596E possibly damaging Het
Sdhd A T 9: 50,515,064 (GRCm39) V9D possibly damaging Het
Serinc5 T C 13: 92,844,565 (GRCm39) S436P probably damaging Het
Slc27a1 C T 8: 72,036,808 (GRCm39) P348L probably damaging Het
Slc28a2b A T 2: 122,344,879 (GRCm39) I162F probably damaging Het
Smg1 G A 7: 117,759,606 (GRCm39) probably benign Het
Sorl1 A T 9: 41,955,196 (GRCm39) probably benign Het
Sprtn T A 8: 125,626,957 (GRCm39) H112Q probably damaging Het
Tasor2 A T 13: 3,626,054 (GRCm39) F1299I probably benign Het
Tet2 A G 3: 133,173,363 (GRCm39) M1633T probably benign Het
Tet2 T A 3: 133,173,486 (GRCm39) D1592V probably benign Het
Tmem68 A T 4: 3,569,667 (GRCm39) C8S probably damaging Het
Tnrc6a T A 7: 122,771,039 (GRCm39) I943N probably benign Het
Trib2 A T 12: 15,844,069 (GRCm39) V191D probably damaging Het
Tsc22d4 T C 5: 137,760,917 (GRCm39) S113P probably damaging Het
Ttc21b T C 2: 66,069,914 (GRCm39) R250G probably damaging Het
Ubr2 T C 17: 47,278,174 (GRCm39) Y721C probably damaging Het
Ubtfl1 A T 9: 18,320,660 (GRCm39) I63F probably damaging Het
Ush1c G A 7: 45,874,332 (GRCm39) P171S probably benign Het
Utp20 A T 10: 88,603,323 (GRCm39) N1843K probably damaging Het
Vangl1 A G 3: 102,074,253 (GRCm39) Y285H probably damaging Het
Virma A G 4: 11,498,769 (GRCm39) D70G probably damaging Het
Vmn2r102 T C 17: 19,898,277 (GRCm39) F431L probably benign Het
Wdr17 A G 8: 55,114,530 (GRCm39) I662T probably damaging Het
Wdr87-ps T A 7: 29,232,690 (GRCm39) noncoding transcript Het
Zfp160 G A 17: 21,247,268 (GRCm39) R606H probably benign Het
Zfp369 C T 13: 65,444,248 (GRCm39) R464C probably damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 29,971,116 (GRCm39) missense probably damaging 0.97
IGL00781:Pkn3 APN 2 29,973,402 (GRCm39) unclassified probably benign
IGL00815:Pkn3 APN 2 29,971,212 (GRCm39) missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 29,977,054 (GRCm39) missense probably damaging 1.00
IGL01897:Pkn3 APN 2 29,972,824 (GRCm39) unclassified probably benign
IGL02513:Pkn3 APN 2 29,973,149 (GRCm39) missense probably damaging 0.98
IGL02552:Pkn3 APN 2 29,970,879 (GRCm39) missense probably damaging 1.00
IGL02622:Pkn3 APN 2 29,973,158 (GRCm39) missense probably benign 0.28
IGL02689:Pkn3 APN 2 29,970,858 (GRCm39) missense probably damaging 1.00
IGL02996:Pkn3 APN 2 29,970,627 (GRCm39) missense probably benign 0.39
IGL03106:Pkn3 APN 2 29,975,257 (GRCm39) missense probably damaging 0.96
Enflamme UTSW 2 29,973,049 (GRCm39) unclassified probably benign
Wrath UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 29,980,539 (GRCm39) missense probably damaging 1.00
R0279:Pkn3 UTSW 2 29,973,309 (GRCm39) missense probably benign 0.16
R0370:Pkn3 UTSW 2 29,977,184 (GRCm39) missense probably damaging 1.00
R0491:Pkn3 UTSW 2 29,979,889 (GRCm39) missense probably damaging 1.00
R1418:Pkn3 UTSW 2 29,973,059 (GRCm39) missense probably damaging 1.00
R1510:Pkn3 UTSW 2 29,969,776 (GRCm39) critical splice donor site probably null
R1535:Pkn3 UTSW 2 29,977,065 (GRCm39) missense probably benign
R1540:Pkn3 UTSW 2 29,974,703 (GRCm39) missense probably damaging 1.00
R1808:Pkn3 UTSW 2 29,969,663 (GRCm39) missense probably damaging 1.00
R1884:Pkn3 UTSW 2 29,972,840 (GRCm39) missense probably damaging 1.00
R1995:Pkn3 UTSW 2 29,979,989 (GRCm39) missense probably damaging 1.00
R3745:Pkn3 UTSW 2 29,980,353 (GRCm39) missense probably damaging 1.00
R4119:Pkn3 UTSW 2 29,973,049 (GRCm39) unclassified probably benign
R4258:Pkn3 UTSW 2 29,978,572 (GRCm39) missense probably damaging 0.99
R4665:Pkn3 UTSW 2 29,975,469 (GRCm39) unclassified probably benign
R4772:Pkn3 UTSW 2 29,974,692 (GRCm39) splice site probably null
R4808:Pkn3 UTSW 2 29,980,093 (GRCm39) missense probably damaging 1.00
R5038:Pkn3 UTSW 2 29,975,293 (GRCm39) critical splice donor site probably null
R5388:Pkn3 UTSW 2 29,971,086 (GRCm39) missense probably damaging 0.99
R5488:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R5611:Pkn3 UTSW 2 29,969,673 (GRCm39) missense probably damaging 1.00
R6001:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R6277:Pkn3 UTSW 2 29,972,957 (GRCm39) missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 29,970,699 (GRCm39) critical splice donor site probably null
R6724:Pkn3 UTSW 2 29,980,562 (GRCm39) missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 29,973,548 (GRCm39) splice site probably null
R7128:Pkn3 UTSW 2 29,973,327 (GRCm39) missense probably damaging 1.00
R7249:Pkn3 UTSW 2 29,974,773 (GRCm39) missense probably benign 0.00
R7475:Pkn3 UTSW 2 29,977,122 (GRCm39) missense probably benign 0.01
R7746:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7747:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7783:Pkn3 UTSW 2 29,969,634 (GRCm39) missense probably damaging 1.00
R8401:Pkn3 UTSW 2 29,970,071 (GRCm39) missense probably benign 0.00
R8425:Pkn3 UTSW 2 29,976,513 (GRCm39) critical splice donor site probably null
R8535:Pkn3 UTSW 2 29,969,936 (GRCm39) critical splice acceptor site probably null
R8720:Pkn3 UTSW 2 29,975,196 (GRCm39) missense probably benign 0.01
R8743:Pkn3 UTSW 2 29,973,318 (GRCm39) missense probably benign 0.00
R9415:Pkn3 UTSW 2 29,968,332 (GRCm39) missense probably benign 0.20
R9437:Pkn3 UTSW 2 29,973,267 (GRCm39) missense possibly damaging 0.93
R9583:Pkn3 UTSW 2 29,976,723 (GRCm39) missense probably null 0.99
R9800:Pkn3 UTSW 2 29,973,290 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCCAGCAGATGTTAAAGGACAG -3'
(R):5'- AAAGGTAAGGGACCCTCTGACGTG -3'

Sequencing Primer
(F):5'- TTGGGTCTATCCACATGCAG -3'
(R):5'- TGAAAGGGAATCCTTGCTACC -3'
Posted On 2013-07-11