Incidental Mutation 'R0600:Or1j12'
ID 55267
Institutional Source Beutler Lab
Gene Symbol Or1j12
Ensembl Gene ENSMUSG00000094266
Gene Name olfactory receptor family 1 subfamily J member 12
Synonyms MOR136-1, GA_x6K02T2NLDC-33147742-33148680, Olfr340
MMRRC Submission 038789-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R0600 (G1)
Quality Score 183
Status Validated
Chromosome 2
Chromosomal Location 36342599-36343537 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36342660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 21 (A21E)
Ref Sequence ENSEMBL: ENSMUSP00000072632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072854]
AlphaFold Q8VGL0
Predicted Effect probably benign
Transcript: ENSMUST00000072854
AA Change: A21E

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072632
Gene: ENSMUSG00000094266
AA Change: A21E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.8e-6 PFAM
Pfam:7tm_1 41 290 1.4e-23 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 130,959,389 (GRCm39) S150P probably damaging Het
5530400C23Rik T G 6: 133,270,174 (GRCm39) probably benign Het
Ahctf1 A C 1: 179,591,033 (GRCm39) probably null Het
Ang5 T C 14: 44,200,206 (GRCm39) V90A probably benign Het
Ano9 C T 7: 140,684,623 (GRCm39) G442R probably damaging Het
Apaf1 G A 10: 90,895,914 (GRCm39) T386I probably damaging Het
Apob C A 12: 8,056,440 (GRCm39) H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 (GRCm39) probably benign Het
Asxl1 T A 2: 153,241,824 (GRCm39) D791E probably benign Het
Avl9 T C 6: 56,713,891 (GRCm39) V383A probably benign Het
Btbd1 A C 7: 81,465,754 (GRCm39) D197E probably damaging Het
Camta2 T C 11: 70,564,785 (GRCm39) I938V possibly damaging Het
Ccn5 G A 2: 163,667,233 (GRCm39) C78Y probably damaging Het
Cdca7 C A 2: 72,313,811 (GRCm39) A200D possibly damaging Het
Cep104 A T 4: 154,091,249 (GRCm39) Y923F possibly damaging Het
Cep135 G C 5: 76,769,152 (GRCm39) V601L probably benign Het
Ces2b G A 8: 105,562,542 (GRCm39) G291S probably benign Het
Col6a6 C T 9: 105,638,639 (GRCm39) G1400D probably damaging Het
Cyth2 T C 7: 45,462,541 (GRCm39) E1G probably damaging Het
Dand5 A T 8: 85,542,921 (GRCm39) L185Q probably damaging Het
Dck T C 5: 88,929,080 (GRCm39) V253A probably benign Het
Ddx20 A G 3: 105,586,396 (GRCm39) S650P probably damaging Het
Dicer1 G A 12: 104,673,123 (GRCm39) P799S probably damaging Het
Dst C T 1: 34,228,200 (GRCm39) P1606L probably damaging Het
Eya2 G A 2: 165,611,157 (GRCm39) C477Y probably damaging Het
Fip1l1 T A 5: 74,756,503 (GRCm39) N498K probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Galntl6 T C 8: 58,290,217 (GRCm39) probably null Het
Gda A T 19: 21,411,667 (GRCm39) F44I possibly damaging Het
Gli2 G A 1: 118,768,119 (GRCm39) R703C probably damaging Het
Golgb1 T A 16: 36,736,633 (GRCm39) L1960Q probably damaging Het
Gramd1b T C 9: 40,219,651 (GRCm39) D341G probably damaging Het
Grid2 G T 6: 63,480,419 (GRCm39) A78S probably benign Het
Hao2 A T 3: 98,790,876 (GRCm39) probably benign Het
Hook3 A G 8: 26,609,014 (GRCm39) V10A probably benign Het
Kif20a A G 18: 34,762,262 (GRCm39) E425G probably damaging Het
Lrp1 T C 10: 127,403,252 (GRCm39) D2107G probably benign Het
Lrriq3 T C 3: 154,893,373 (GRCm39) I358T possibly damaging Het
Mad2l2 A G 4: 148,225,381 (GRCm39) D17G possibly damaging Het
Mastl G T 2: 23,023,358 (GRCm39) T455K probably benign Het
Mkln1 G T 6: 31,409,862 (GRCm39) probably benign Het
Mmp1b A T 9: 7,387,947 (GRCm39) Y16N possibly damaging Het
Mmp24 C T 2: 155,634,517 (GRCm39) A79V probably benign Het
Mrps35 T A 6: 146,972,232 (GRCm39) C292S possibly damaging Het
Myom1 T C 17: 71,427,643 (GRCm39) F1435L possibly damaging Het
Nars2 C T 7: 96,689,130 (GRCm39) H351Y probably damaging Het
Nat2 A T 8: 67,953,919 (GRCm39) I10F probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm5 A T 7: 103,803,076 (GRCm39) Y462* probably null Het
Or13p5 C T 4: 118,591,986 (GRCm39) H87Y probably damaging Het
Or2w3 C A 11: 58,556,986 (GRCm39) F200L probably damaging Het
Or4c122 C A 2: 89,079,742 (GRCm39) E87* probably null Het
Or4e1 T C 14: 52,700,966 (GRCm39) I167V probably benign Het
Or5p70 T A 7: 107,994,438 (GRCm39) I37N probably damaging Het
Or7g35 T C 9: 19,496,600 (GRCm39) S256P possibly damaging Het
Or8d2b T A 9: 38,789,111 (GRCm39) I213N probably damaging Het
Or8g20 A T 9: 39,396,284 (GRCm39) F85L probably benign Het
Otog A T 7: 45,900,819 (GRCm39) probably benign Het
Pdcd2l A T 7: 33,892,232 (GRCm39) D212E possibly damaging Het
Pex5 T C 6: 124,381,596 (GRCm39) N213S probably benign Het
Pkn3 C T 2: 29,971,146 (GRCm39) P238S probably benign Het
Pramel32 A T 4: 88,547,536 (GRCm39) I45K probably damaging Het
Prl2b1 A T 13: 27,574,723 (GRCm39) probably null Het
Ptprb A T 10: 116,204,712 (GRCm39) I1849L possibly damaging Het
Rasal3 G T 17: 32,612,500 (GRCm39) S787Y probably damaging Het
Scn2a T A 2: 65,532,177 (GRCm39) D596E possibly damaging Het
Sdhd A T 9: 50,515,064 (GRCm39) V9D possibly damaging Het
Serinc5 T C 13: 92,844,565 (GRCm39) S436P probably damaging Het
Slc27a1 C T 8: 72,036,808 (GRCm39) P348L probably damaging Het
Slc28a2b A T 2: 122,344,879 (GRCm39) I162F probably damaging Het
Smg1 G A 7: 117,759,606 (GRCm39) probably benign Het
Sorl1 A T 9: 41,955,196 (GRCm39) probably benign Het
Sprtn T A 8: 125,626,957 (GRCm39) H112Q probably damaging Het
Tasor2 A T 13: 3,626,054 (GRCm39) F1299I probably benign Het
Tet2 A G 3: 133,173,363 (GRCm39) M1633T probably benign Het
Tet2 T A 3: 133,173,486 (GRCm39) D1592V probably benign Het
Tmem68 A T 4: 3,569,667 (GRCm39) C8S probably damaging Het
Tnrc6a T A 7: 122,771,039 (GRCm39) I943N probably benign Het
Trib2 A T 12: 15,844,069 (GRCm39) V191D probably damaging Het
Tsc22d4 T C 5: 137,760,917 (GRCm39) S113P probably damaging Het
Ttc21b T C 2: 66,069,914 (GRCm39) R250G probably damaging Het
Ubr2 T C 17: 47,278,174 (GRCm39) Y721C probably damaging Het
Ubtfl1 A T 9: 18,320,660 (GRCm39) I63F probably damaging Het
Ush1c G A 7: 45,874,332 (GRCm39) P171S probably benign Het
Utp20 A T 10: 88,603,323 (GRCm39) N1843K probably damaging Het
Vangl1 A G 3: 102,074,253 (GRCm39) Y285H probably damaging Het
Virma A G 4: 11,498,769 (GRCm39) D70G probably damaging Het
Vmn2r102 T C 17: 19,898,277 (GRCm39) F431L probably benign Het
Wdr17 A G 8: 55,114,530 (GRCm39) I662T probably damaging Het
Wdr87-ps T A 7: 29,232,690 (GRCm39) noncoding transcript Het
Zfp160 G A 17: 21,247,268 (GRCm39) R606H probably benign Het
Zfp369 C T 13: 65,444,248 (GRCm39) R464C probably damaging Het
Other mutations in Or1j12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Or1j12 APN 2 36,342,656 (GRCm39) nonsense probably null
IGL01590:Or1j12 APN 2 36,343,004 (GRCm39) missense probably benign 0.39
IGL01614:Or1j12 APN 2 36,342,636 (GRCm39) missense probably benign 0.32
IGL02470:Or1j12 APN 2 36,342,609 (GRCm39) missense probably benign 0.00
IGL02943:Or1j12 APN 2 36,343,051 (GRCm39) missense probably benign 0.05
R0089:Or1j12 UTSW 2 36,343,107 (GRCm39) missense probably benign 0.00
R0881:Or1j12 UTSW 2 36,343,452 (GRCm39) missense probably damaging 1.00
R1945:Or1j12 UTSW 2 36,343,043 (GRCm39) missense probably damaging 1.00
R2184:Or1j12 UTSW 2 36,343,046 (GRCm39) missense probably benign
R2196:Or1j12 UTSW 2 36,342,600 (GRCm39) start codon destroyed probably null 1.00
R2419:Or1j12 UTSW 2 36,343,338 (GRCm39) missense probably damaging 1.00
R2859:Or1j12 UTSW 2 36,343,142 (GRCm39) missense probably benign 0.01
R2964:Or1j12 UTSW 2 36,342,779 (GRCm39) missense probably damaging 1.00
R4677:Or1j12 UTSW 2 36,343,062 (GRCm39) missense probably benign 0.00
R4867:Or1j12 UTSW 2 36,343,211 (GRCm39) missense probably benign
R5468:Or1j12 UTSW 2 36,343,455 (GRCm39) missense probably damaging 0.99
R5582:Or1j12 UTSW 2 36,343,233 (GRCm39) missense probably benign 0.03
R6335:Or1j12 UTSW 2 36,342,734 (GRCm39) missense probably benign 0.22
R6415:Or1j12 UTSW 2 36,342,617 (GRCm39) missense probably damaging 0.99
R6664:Or1j12 UTSW 2 36,343,110 (GRCm39) missense probably benign 0.00
R6873:Or1j12 UTSW 2 36,343,508 (GRCm39) missense probably benign 0.00
R7097:Or1j12 UTSW 2 36,342,702 (GRCm39) missense probably damaging 1.00
R7122:Or1j12 UTSW 2 36,342,702 (GRCm39) missense probably damaging 1.00
R7199:Or1j12 UTSW 2 36,342,872 (GRCm39) missense probably damaging 1.00
R7275:Or1j12 UTSW 2 36,342,851 (GRCm39) missense probably benign 0.05
R7812:Or1j12 UTSW 2 36,343,290 (GRCm39) missense probably benign 0.00
R8260:Or1j12 UTSW 2 36,342,897 (GRCm39) missense probably damaging 1.00
R9061:Or1j12 UTSW 2 36,342,897 (GRCm39) missense probably damaging 1.00
Z1088:Or1j12 UTSW 2 36,342,918 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CCAGGCATCTTGATCTACAACTGGG -3'
(R):5'- GTCTGTGAAGGCCAAGTGACTGAG -3'

Sequencing Primer
(F):5'- GATCTACAACTGGGTCTCATCTG -3'
(R):5'- TGACTGAGGAAGAAGTACATGG -3'
Posted On 2013-07-11