Incidental Mutation 'R7131:Atrip'
Institutional Source Beutler Lab
Gene Symbol Atrip
Ensembl Gene ENSMUSG00000025646
Gene NameATR interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7131 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location109057933-109074124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109060420 bp
Amino Acid Change Isoleucine to Methionine at position 711 (I711M)
Ref Sequence ENSEMBL: ENSMUSP00000044831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026737] [ENSMUST00000045011] [ENSMUST00000061973] [ENSMUST00000112053] [ENSMUST00000112059] [ENSMUST00000128062] [ENSMUST00000154184] [ENSMUST00000159614] [ENSMUST00000160217] [ENSMUST00000161521] [ENSMUST00000196954] [ENSMUST00000197099] [ENSMUST00000197483] [ENSMUST00000197689] [ENSMUST00000198295] [ENSMUST00000198376] [ENSMUST00000198708] [ENSMUST00000200515] [ENSMUST00000200629]
Predicted Effect probably benign
Transcript: ENSMUST00000026737
SMART Domains Protein: ENSMUSP00000026737
Gene: ENSMUSG00000025647

low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 24 211 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045011
AA Change: I711M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044831
Gene: ENSMUSG00000025646
AA Change: I711M

SCOP:d1eq1a_ 96 193 8e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061973
SMART Domains Protein: ENSMUSP00000050971
Gene: ENSMUSG00000049734

EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112053
SMART Domains Protein: ENSMUSP00000107684
Gene: ENSMUSG00000049734

EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112059
SMART Domains Protein: ENSMUSP00000107690
Gene: ENSMUSG00000025647

low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 26 198 1.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128062
SMART Domains Protein: ENSMUSP00000118499
Gene: ENSMUSG00000025646

PDB:3MXJ|A 1 150 4e-97 PDB
SCOP:d1fxxa_ 12 146 7e-12 SMART
Blast:EXOIII 13 150 1e-85 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154184
SMART Domains Protein: ENSMUSP00000128901
Gene: ENSMUSG00000025647

Pfam:Shisa 1 108 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159614
SMART Domains Protein: ENSMUSP00000124854
Gene: ENSMUSG00000025646

signal peptide 1 17 N/A INTRINSIC
low complexity region 54 60 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160217
SMART Domains Protein: ENSMUSP00000125264
Gene: ENSMUSG00000025646

SCOP:d1eq1a_ 96 193 3e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 533 550 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161521
AA Change: I684M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125615
Gene: ENSMUSG00000025646
AA Change: I684M

coiled coil region 108 208 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196954
SMART Domains Protein: ENSMUSP00000143599
Gene: ENSMUSG00000025647

Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197099
SMART Domains Protein: ENSMUSP00000143648
Gene: ENSMUSG00000025647

Pfam:Shisa 1 129 9.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197483
SMART Domains Protein: ENSMUSP00000143613
Gene: ENSMUSG00000025647

Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197689
SMART Domains Protein: ENSMUSP00000142874
Gene: ENSMUSG00000025647

Pfam:Shisa 1 63 4.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198295
SMART Domains Protein: ENSMUSP00000143721
Gene: ENSMUSG00000025647

Pfam:Shisa 1 70 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198376
SMART Domains Protein: ENSMUSP00000143374
Gene: ENSMUSG00000025647

Pfam:Shisa 1 83 5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198708
SMART Domains Protein: ENSMUSP00000142978
Gene: ENSMUSG00000025647

Pfam:Shisa 1 109 7.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199868
Predicted Effect probably benign
Transcript: ENSMUST00000200515
SMART Domains Protein: ENSMUSP00000142835
Gene: ENSMUSG00000025647

Pfam:Shisa 11 147 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200629
SMART Domains Protein: ENSMUSP00000142404
Gene: ENSMUSG00000025647

Pfam:Shisa 1 72 1.9e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,548,956 V435A possibly damaging Het
Abca13 A G 11: 9,291,893 N1252S probably benign Het
Abcc3 A T 11: 94,365,031 F543I probably damaging Het
Adam15 T A 3: 89,346,980 Q170L possibly damaging Het
AF366264 A T 8: 13,836,982 W370R probably damaging Het
Aldoc A G 11: 78,324,456 I19V possibly damaging Het
Brwd1 A C 16: 96,066,498 L149R probably damaging Het
Capn9 A T 8: 124,576,278 D45V probably damaging Het
Card9 G A 2: 26,358,835 R101C probably damaging Het
Casc1 A T 6: 145,177,406 L578Q probably null Het
Ccdc36 A T 9: 108,417,420 D98E probably benign Het
Ccdc87 A G 19: 4,841,757 E759G probably damaging Het
Cep250 T C 2: 155,965,077 M193T probably damaging Het
Cfap54 T C 10: 92,821,104 K3029E probably benign Het
Chrna9 G A 5: 65,977,141 G445D possibly damaging Het
Cluap1 C T 16: 3,940,775 S367L probably benign Het
Col5a1 A G 2: 27,929,486 D200G unknown Het
Crhr2 T C 6: 55,092,127 N388D Het
Cyp2b23 A G 7: 26,681,413 L129P probably benign Het
Cyr61 T C 3: 145,648,781 D125G probably damaging Het
Dctd A G 8: 48,112,040 S67G probably benign Het
Dhtkd1 C G 2: 5,904,070 V738L probably benign Het
Dnah17 C T 11: 118,079,658 D2173N probably benign Het
Dnah7c G T 1: 46,681,772 A2819S probably benign Het
Dot1l A G 10: 80,792,341 H1071R unknown Het
Doxl2 T A 6: 48,976,372 Y410* probably null Het
Dync2h1 T A 9: 7,075,786 D3027V probably damaging Het
Efl1 A G 7: 82,658,064 Y56C probably damaging Het
Eif4e1b A T 13: 54,784,100 R29W probably null Het
Evc2 A G 5: 37,410,258 R860G probably damaging Het
Fbxl12 G A 9: 20,644,383 probably benign Het
Fibp T A 19: 5,461,491 I129N probably damaging Het
Folh1 G T 7: 86,726,112 H555Q probably damaging Het
Gcnt4 A T 13: 96,946,519 T108S probably damaging Het
Gm436 A G 4: 144,670,067 V365A probably damaging Het
H1fnt T A 15: 98,256,369 K300* probably null Het
Hecw2 A T 1: 53,865,121 V1156E probably damaging Het
Herc3 C G 6: 58,887,424 A681G probably damaging Het
Igkv13-84 T A 6: 68,939,780 C20* probably null Het
Ivd C A 2: 118,869,774 T94K probably damaging Het
Kank2 C T 9: 21,794,679 A348T probably benign Het
Kcnma1 T C 14: 23,367,494 Y889C probably damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,849,616 probably benign Het
Kmt5b T A 19: 3,815,412 D825E probably benign Het
Krt39 C T 11: 99,520,871 A130T probably benign Het
Krtap4-9 C T 11: 99,785,457 T68I unknown Het
Lmbr1l A T 15: 98,906,323 V365E probably benign Het
Lonp1 C T 17: 56,617,814 R531Q probably damaging Het
Mecom T A 3: 29,980,945 H194L probably damaging Het
Mlx C T 11: 101,089,242 H188Y probably damaging Het
Mrps10 T C 17: 47,375,015 S77P probably damaging Het
Mst1 A G 9: 108,084,931 E716G probably null Het
Mttp C T 3: 138,116,132 V210I probably benign Het
Mug2 T C 6: 122,075,247 V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 M1T probably null Het
Neurog1 A T 13: 56,251,750 N61K probably benign Het
Nlrp14 A G 7: 107,184,814 D581G possibly damaging Het
Nlrp4a C A 7: 26,449,833 N288K probably benign Het
Notch3 T A 17: 32,144,217 H1264L probably benign Het
Olfr384 A T 11: 73,602,736 D52V possibly damaging Het
Olfr394 A T 11: 73,887,954 C139* probably null Het
Olfr402 A G 11: 74,155,780 M209V probably benign Het
Patl2 A T 2: 122,121,782 probably null Het
Pfkfb4 A G 9: 109,007,302 T133A probably benign Het
Pla2g4f T C 2: 120,304,554 E471G probably null Het
Postn T C 3: 54,362,635 V45A probably damaging Het
Ppan T A 9: 20,891,154 V257E possibly damaging Het
Ptcra C G 17: 46,763,596 A7P probably damaging Het
Ptprd C T 4: 76,066,340 R523H probably damaging Het
Pycrl A T 15: 75,918,695 I105N possibly damaging Het
Rfx1 C A 8: 84,095,079 Q815K probably damaging Het
Rfx3 T A 19: 27,768,628 K668* probably null Het
Ryr2 A T 13: 11,640,327 D3661E possibly damaging Het
Ryr2 A G 13: 11,668,811 probably null Het
Sec23ip T A 7: 128,779,640 S974T probably damaging Het
Setbp1 A G 18: 79,086,960 F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,796,418 probably benign Het
Sh3pxd2b A G 11: 32,422,072 K413R probably damaging Het
Slc39a12 T C 2: 14,449,803 V544A probably damaging Het
Slc6a7 T C 18: 61,002,202 Y418C probably damaging Het
Snx19 T G 9: 30,427,893 I109S probably damaging Het
Spg20 T C 3: 55,121,799 probably null Het
Sptbn2 A T 19: 4,749,460 Q2097L probably null Het
Syne1 T C 10: 5,228,221 K4751R probably damaging Het
Tigit C A 16: 43,662,252 G40C probably damaging Het
Tmem181a T A 17: 6,297,972 I264K probably damaging Het
Tom1 T A 8: 75,057,249 I287N possibly damaging Het
Top2a G A 11: 99,004,182 P864L possibly damaging Het
Trmt44 A T 5: 35,571,066 V290E probably damaging Het
Try4 T C 6: 41,304,403 I93T probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Uspl1 A T 5: 149,193,935 R109S probably benign Het
Vav3 T A 3: 109,664,346 F755I probably damaging Het
Vezt A T 10: 93,970,547 Y667* probably null Het
Vmn1r231 T A 17: 20,889,878 L258F possibly damaging Het
Zfp207 T C 11: 80,395,528 M489T unknown Het
Zfp462 A G 4: 55,009,380 T449A probably benign Het
Zfp956 C A 6: 47,955,847 Q19K probably benign Het
Zkscan8 A T 13: 21,525,273 W152R probably damaging Het
Other mutations in Atrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Atrip APN 9 109069295 missense probably damaging 1.00
IGL02176:Atrip APN 9 109067046 missense probably benign 0.06
IGL02227:Atrip APN 9 109061664 missense possibly damaging 0.86
IGL02344:Atrip APN 9 109072624 nonsense probably null
IGL02406:Atrip APN 9 109065419 missense probably damaging 0.99
IGL02457:Atrip APN 9 109065231 missense possibly damaging 0.95
IGL02823:Atrip APN 9 109061178 missense probably damaging 1.00
PIT4508001:Atrip UTSW 9 109073989 missense possibly damaging 0.93
R0637:Atrip UTSW 9 109061173 missense possibly damaging 0.58
R0709:Atrip UTSW 9 109067103 missense probably benign 0.00
R1452:Atrip UTSW 9 109072659 missense probably damaging 1.00
R1944:Atrip UTSW 9 109071867 missense probably damaging 1.00
R1945:Atrip UTSW 9 109071867 missense probably damaging 1.00
R2081:Atrip UTSW 9 109072739 critical splice acceptor site probably null
R4588:Atrip UTSW 9 109060279 missense probably damaging 1.00
R5032:Atrip UTSW 9 109065203 missense probably benign 0.02
R5088:Atrip UTSW 9 109059896 missense probably damaging 0.97
R5696:Atrip UTSW 9 109065501 missense possibly damaging 0.59
R6104:Atrip UTSW 9 109065564 missense possibly damaging 0.94
R6136:Atrip UTSW 9 109071736 missense probably damaging 1.00
R7071:Atrip UTSW 9 109067014 splice site probably null
R7467:Atrip UTSW 9 109069354 missense probably damaging 1.00
R7734:Atrip UTSW 9 109065506 missense probably benign 0.09
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-15