Incidental Mutation 'R7131:Syne1'
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7131 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5228221 bp
Amino Acid Change Lysine to Arginine at position 4751 (K4751R)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000215295
AA Change: K4751R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,548,956 V435A possibly damaging Het
Abca13 A G 11: 9,291,893 N1252S probably benign Het
Abcc3 A T 11: 94,365,031 F543I probably damaging Het
Adam15 T A 3: 89,346,980 Q170L possibly damaging Het
AF366264 A T 8: 13,836,982 W370R probably damaging Het
Aldoc A G 11: 78,324,456 I19V possibly damaging Het
Atrip T C 9: 109,060,420 I711M probably benign Het
Brwd1 A C 16: 96,066,498 L149R probably damaging Het
Capn9 A T 8: 124,576,278 D45V probably damaging Het
Card9 G A 2: 26,358,835 R101C probably damaging Het
Casc1 A T 6: 145,177,406 L578Q probably null Het
Ccdc36 A T 9: 108,417,420 D98E probably benign Het
Ccdc87 A G 19: 4,841,757 E759G probably damaging Het
Cep250 T C 2: 155,965,077 M193T probably damaging Het
Cfap54 T C 10: 92,821,104 K3029E probably benign Het
Chrna9 G A 5: 65,977,141 G445D possibly damaging Het
Cluap1 C T 16: 3,940,775 S367L probably benign Het
Col5a1 A G 2: 27,929,486 D200G unknown Het
Crhr2 T C 6: 55,092,127 N388D Het
Cyp2b23 A G 7: 26,681,413 L129P probably benign Het
Cyr61 T C 3: 145,648,781 D125G probably damaging Het
Dctd A G 8: 48,112,040 S67G probably benign Het
Dhtkd1 C G 2: 5,904,070 V738L probably benign Het
Dnah17 C T 11: 118,079,658 D2173N probably benign Het
Dnah7c G T 1: 46,681,772 A2819S probably benign Het
Dot1l A G 10: 80,792,341 H1071R unknown Het
Doxl2 T A 6: 48,976,372 Y410* probably null Het
Dync2h1 T A 9: 7,075,786 D3027V probably damaging Het
Efl1 A G 7: 82,658,064 Y56C probably damaging Het
Eif4e1b A T 13: 54,784,100 R29W probably null Het
Evc2 A G 5: 37,410,258 R860G probably damaging Het
Fbxl12 G A 9: 20,644,383 probably benign Het
Fibp T A 19: 5,461,491 I129N probably damaging Het
Folh1 G T 7: 86,726,112 H555Q probably damaging Het
Gcnt4 A T 13: 96,946,519 T108S probably damaging Het
Gm436 A G 4: 144,670,067 V365A probably damaging Het
H1fnt T A 15: 98,256,369 K300* probably null Het
Hecw2 A T 1: 53,865,121 V1156E probably damaging Het
Herc3 C G 6: 58,887,424 A681G probably damaging Het
Igkv13-84 T A 6: 68,939,780 C20* probably null Het
Ivd C A 2: 118,869,774 T94K probably damaging Het
Kank2 C T 9: 21,794,679 A348T probably benign Het
Kcnma1 T C 14: 23,367,494 Y889C probably damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,849,616 probably benign Het
Kmt5b T A 19: 3,815,412 D825E probably benign Het
Krt39 C T 11: 99,520,871 A130T probably benign Het
Krtap4-9 C T 11: 99,785,457 T68I unknown Het
Lmbr1l A T 15: 98,906,323 V365E probably benign Het
Lonp1 C T 17: 56,617,814 R531Q probably damaging Het
Mecom T A 3: 29,980,945 H194L probably damaging Het
Mlx C T 11: 101,089,242 H188Y probably damaging Het
Mrps10 T C 17: 47,375,015 S77P probably damaging Het
Mst1 A G 9: 108,084,931 E716G probably null Het
Mttp C T 3: 138,116,132 V210I probably benign Het
Mug2 T C 6: 122,075,247 V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 M1T probably null Het
Neurog1 A T 13: 56,251,750 N61K probably benign Het
Nlrp14 A G 7: 107,184,814 D581G possibly damaging Het
Nlrp4a C A 7: 26,449,833 N288K probably benign Het
Notch3 T A 17: 32,144,217 H1264L probably benign Het
Olfr384 A T 11: 73,602,736 D52V possibly damaging Het
Olfr394 A T 11: 73,887,954 C139* probably null Het
Olfr402 A G 11: 74,155,780 M209V probably benign Het
Patl2 A T 2: 122,121,782 probably null Het
Pfkfb4 A G 9: 109,007,302 T133A probably benign Het
Pla2g4f T C 2: 120,304,554 E471G probably null Het
Postn T C 3: 54,362,635 V45A probably damaging Het
Ppan T A 9: 20,891,154 V257E possibly damaging Het
Ptcra C G 17: 46,763,596 A7P probably damaging Het
Ptprd C T 4: 76,066,340 R523H probably damaging Het
Pycrl A T 15: 75,918,695 I105N possibly damaging Het
Rfx1 C A 8: 84,095,079 Q815K probably damaging Het
Rfx3 T A 19: 27,768,628 K668* probably null Het
Ryr2 A T 13: 11,640,327 D3661E possibly damaging Het
Ryr2 A G 13: 11,668,811 probably null Het
Sec23ip T A 7: 128,779,640 S974T probably damaging Het
Setbp1 A G 18: 79,086,960 F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,796,418 probably benign Het
Sh3pxd2b A G 11: 32,422,072 K413R probably damaging Het
Slc39a12 T C 2: 14,449,803 V544A probably damaging Het
Slc6a7 T C 18: 61,002,202 Y418C probably damaging Het
Snx19 T G 9: 30,427,893 I109S probably damaging Het
Spg20 T C 3: 55,121,799 probably null Het
Sptbn2 A T 19: 4,749,460 Q2097L probably null Het
Tigit C A 16: 43,662,252 G40C probably damaging Het
Tmem181a T A 17: 6,297,972 I264K probably damaging Het
Tom1 T A 8: 75,057,249 I287N possibly damaging Het
Top2a G A 11: 99,004,182 P864L possibly damaging Het
Trmt44 A T 5: 35,571,066 V290E probably damaging Het
Try4 T C 6: 41,304,403 I93T probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Uspl1 A T 5: 149,193,935 R109S probably benign Het
Vav3 T A 3: 109,664,346 F755I probably damaging Het
Vezt A T 10: 93,970,547 Y667* probably null Het
Vmn1r231 T A 17: 20,889,878 L258F possibly damaging Het
Zfp207 T C 11: 80,395,528 M489T unknown Het
Zfp462 A G 4: 55,009,380 T449A probably benign Het
Zfp956 C A 6: 47,955,847 Q19K probably benign Het
Zkscan8 A T 13: 21,525,273 W152R probably damaging Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5333023 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7132:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7133:Syne1 UTSW 10 5231592 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7189:Syne1 UTSW 10 5424295 missense probably benign 0.03
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5424382 missense probably damaging 1.00
R7577:Syne1 UTSW 10 5124820 missense probably damaging 1.00
R7579:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R7594:Syne1 UTSW 10 5215190 critical splice donor site probably null
R7646:Syne1 UTSW 10 5172949 missense probably damaging 1.00
R7651:Syne1 UTSW 10 5205074 missense probably benign 0.38
R7651:Syne1 UTSW 10 5343416 missense probably damaging 1.00
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-15