Incidental Mutation 'R7131:Krt39'
ID 552684
Institutional Source Beutler Lab
Gene Symbol Krt39
Ensembl Gene ENSMUSG00000064165
Gene Name keratin 39
Synonyms 4732494G06Rik
MMRRC Submission 045216-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 99404940-99412164 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99411697 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 130 (A130T)
Ref Sequence ENSEMBL: ENSMUSP00000076216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076948] [ENSMUST00000107445]
AlphaFold Q6IFX4
Predicted Effect probably benign
Transcript: ENSMUST00000076948
AA Change: A130T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076216
Gene: ENSMUSG00000064165
AA Change: A130T

DomainStartEndE-ValueType
Pfam:Filament 90 401 7.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107445
AA Change: A130T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103069
Gene: ENSMUSG00000064165
AA Change: A130T

DomainStartEndE-ValueType
Filament 90 401 2.63e-130 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,637 (GRCm39) V365A probably damaging Het
Abca13 A G 11: 9,241,893 (GRCm39) N1252S probably benign Het
Abcc3 A T 11: 94,255,857 (GRCm39) F543I probably damaging Het
Adam15 T A 3: 89,254,287 (GRCm39) Q170L possibly damaging Het
Aldoc A G 11: 78,215,282 (GRCm39) I19V possibly damaging Het
Aoc1l1 T A 6: 48,953,306 (GRCm39) Y410* probably null Het
Atrip T C 9: 108,889,488 (GRCm39) I711M probably benign Het
Brwd1 A C 16: 95,867,698 (GRCm39) L149R probably damaging Het
Capn9 A T 8: 125,303,017 (GRCm39) D45V probably damaging Het
Card9 G A 2: 26,248,847 (GRCm39) R101C probably damaging Het
Ccdc87 A G 19: 4,891,785 (GRCm39) E759G probably damaging Het
Ccn1 T C 3: 145,354,536 (GRCm39) D125G probably damaging Het
Cep250 T C 2: 155,806,997 (GRCm39) M193T probably damaging Het
Cfap54 T C 10: 92,656,966 (GRCm39) K3029E probably benign Het
Chrna9 G A 5: 66,134,484 (GRCm39) G445D possibly damaging Het
Cluap1 C T 16: 3,758,639 (GRCm39) S367L probably benign Het
Col5a1 A G 2: 27,819,498 (GRCm39) D200G unknown Het
Crhr2 T C 6: 55,069,112 (GRCm39) N388D Het
Cyp2b23 A G 7: 26,380,838 (GRCm39) L129P probably benign Het
Dctd A G 8: 48,565,075 (GRCm39) S67G probably benign Het
Dhtkd1 C G 2: 5,908,881 (GRCm39) V738L probably benign Het
Dnah17 C T 11: 117,970,484 (GRCm39) D2173N probably benign Het
Dnah7c G T 1: 46,720,932 (GRCm39) A2819S probably benign Het
Dnai7 A T 6: 145,123,132 (GRCm39) L578Q probably null Het
Dot1l A G 10: 80,628,175 (GRCm39) H1071R unknown Het
Dync2h1 T A 9: 7,075,786 (GRCm39) D3027V probably damaging Het
Efl1 A G 7: 82,307,272 (GRCm39) Y56C probably damaging Het
Eif4e1b A T 13: 54,931,913 (GRCm39) R29W probably null Het
Evc2 A G 5: 37,567,602 (GRCm39) R860G probably damaging Het
Fbxl12 G A 9: 20,555,679 (GRCm39) probably benign Het
Fibp T A 19: 5,511,519 (GRCm39) I129N probably damaging Het
Folh1 G T 7: 86,375,320 (GRCm39) H555Q probably damaging Het
Gcnt4 A T 13: 97,083,027 (GRCm39) T108S probably damaging Het
H1f7 T A 15: 98,154,250 (GRCm39) K300* probably null Het
Hecw2 A T 1: 53,904,280 (GRCm39) V1156E probably damaging Het
Herc3 C G 6: 58,864,409 (GRCm39) A681G probably damaging Het
Igkv13-84 T A 6: 68,916,764 (GRCm39) C20* probably null Het
Iho1 A T 9: 108,294,619 (GRCm39) D98E probably benign Het
Iqca1l A G 5: 24,753,954 (GRCm39) V435A possibly damaging Het
Ivd C A 2: 118,700,255 (GRCm39) T94K probably damaging Het
Kank2 C T 9: 21,705,975 (GRCm39) A348T probably benign Het
Kcnma1 T C 14: 23,417,562 (GRCm39) Y889C probably damaging Het
Kif13b T C 14: 65,010,517 (GRCm39) V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,747,497 (GRCm39) probably benign Het
Kmt5b T A 19: 3,865,412 (GRCm39) D825E probably benign Het
Krtap4-9 C T 11: 99,676,283 (GRCm39) T68I unknown Het
Lmbr1l A T 15: 98,804,204 (GRCm39) V365E probably benign Het
Lonp1 C T 17: 56,924,814 (GRCm39) R531Q probably damaging Het
Mecom T A 3: 30,035,094 (GRCm39) H194L probably damaging Het
Mlx C T 11: 100,980,068 (GRCm39) H188Y probably damaging Het
Mrps10 T C 17: 47,685,940 (GRCm39) S77P probably damaging Het
Mst1 A G 9: 107,962,130 (GRCm39) E716G probably null Het
Mttp C T 3: 137,821,893 (GRCm39) V210I probably benign Het
Mug2 T C 6: 122,052,206 (GRCm39) V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 (GRCm39) M1T probably null Het
Neurog1 A T 13: 56,399,563 (GRCm39) N61K probably benign Het
Nlrp14 A G 7: 106,784,021 (GRCm39) D581G possibly damaging Het
Nlrp4a C A 7: 26,149,258 (GRCm39) N288K probably benign Het
Notch3 T A 17: 32,363,191 (GRCm39) H1264L probably benign Het
Or1e25 A T 11: 73,493,562 (GRCm39) D52V possibly damaging Het
Or1e34 A T 11: 73,778,780 (GRCm39) C139* probably null Het
Or3a1c A G 11: 74,046,606 (GRCm39) M209V probably benign Het
Patl2 A T 2: 121,952,263 (GRCm39) probably null Het
Pfkfb4 A G 9: 108,836,370 (GRCm39) T133A probably benign Het
Pla2g4f T C 2: 120,135,035 (GRCm39) E471G probably null Het
Postn T C 3: 54,270,056 (GRCm39) V45A probably damaging Het
Ppan T A 9: 20,802,450 (GRCm39) V257E possibly damaging Het
Ptcra C G 17: 47,074,522 (GRCm39) A7P probably damaging Het
Ptprd C T 4: 75,984,577 (GRCm39) R523H probably damaging Het
Pycr3 A T 15: 75,790,544 (GRCm39) I105N possibly damaging Het
Rfx1 C A 8: 84,821,708 (GRCm39) Q815K probably damaging Het
Rfx3 T A 19: 27,746,028 (GRCm39) K668* probably null Het
Ryr2 A T 13: 11,655,213 (GRCm39) D3661E possibly damaging Het
Ryr2 A G 13: 11,683,697 (GRCm39) probably null Het
Sec23ip T A 7: 128,381,364 (GRCm39) S974T probably damaging Het
Semp2l2a A T 8: 13,886,982 (GRCm39) W370R probably damaging Het
Setbp1 A G 18: 79,130,175 (GRCm39) F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,395,590 (GRCm39) probably benign Het
Sh3pxd2b A G 11: 32,372,072 (GRCm39) K413R probably damaging Het
Slc39a12 T C 2: 14,454,614 (GRCm39) V544A probably damaging Het
Slc6a7 T C 18: 61,135,274 (GRCm39) Y418C probably damaging Het
Snx19 T G 9: 30,339,189 (GRCm39) I109S probably damaging Het
Spart T C 3: 55,029,220 (GRCm39) probably null Het
Sptbn2 A T 19: 4,799,488 (GRCm39) Q2097L probably null Het
Syne1 T C 10: 5,178,221 (GRCm39) K4751R probably damaging Het
Tigit C A 16: 43,482,615 (GRCm39) G40C probably damaging Het
Tmem181a T A 17: 6,348,247 (GRCm39) I264K probably damaging Het
Tom1 T A 8: 75,783,877 (GRCm39) I287N possibly damaging Het
Top2a G A 11: 98,895,008 (GRCm39) P864L possibly damaging Het
Trmt44 A T 5: 35,728,410 (GRCm39) V290E probably damaging Het
Try4 T C 6: 41,281,337 (GRCm39) I93T probably benign Het
Usp24 T A 4: 106,239,500 (GRCm39) H1147Q possibly damaging Het
Uspl1 A T 5: 149,130,745 (GRCm39) R109S probably benign Het
Vav3 T A 3: 109,571,662 (GRCm39) F755I probably damaging Het
Vezt A T 10: 93,806,409 (GRCm39) Y667* probably null Het
Vmn1r231 T A 17: 21,110,140 (GRCm39) L258F possibly damaging Het
Zfp207 T C 11: 80,286,354 (GRCm39) M489T unknown Het
Zfp462 A G 4: 55,009,380 (GRCm39) T449A probably benign Het
Zfp956 C A 6: 47,932,781 (GRCm39) Q19K probably benign Het
Zkscan8 A T 13: 21,709,443 (GRCm39) W152R probably damaging Het
Other mutations in Krt39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Krt39 APN 11 99,409,889 (GRCm39) missense probably damaging 0.97
IGL02179:Krt39 APN 11 99,411,667 (GRCm39) missense probably damaging 1.00
IGL02478:Krt39 APN 11 99,411,723 (GRCm39) missense probably benign 0.37
IGL02578:Krt39 APN 11 99,412,032 (GRCm39) missense probably benign 0.00
IGL03090:Krt39 APN 11 99,409,833 (GRCm39) splice site probably benign
IGL03094:Krt39 APN 11 99,411,628 (GRCm39) splice site probably benign
R0532:Krt39 UTSW 11 99,405,617 (GRCm39) missense possibly damaging 0.92
R0789:Krt39 UTSW 11 99,411,888 (GRCm39) missense probably benign 0.00
R1856:Krt39 UTSW 11 99,409,914 (GRCm39) nonsense probably null
R1920:Krt39 UTSW 11 99,405,461 (GRCm39) missense probably benign 0.00
R1944:Krt39 UTSW 11 99,410,649 (GRCm39) missense probably damaging 1.00
R4391:Krt39 UTSW 11 99,405,578 (GRCm39) missense probably benign 0.01
R4678:Krt39 UTSW 11 99,411,826 (GRCm39) missense probably benign 0.02
R4921:Krt39 UTSW 11 99,405,575 (GRCm39) missense possibly damaging 0.80
R5800:Krt39 UTSW 11 99,411,971 (GRCm39) missense probably benign 0.09
R6207:Krt39 UTSW 11 99,412,041 (GRCm39) missense probably damaging 1.00
R6904:Krt39 UTSW 11 99,410,647 (GRCm39) missense probably damaging 1.00
R7034:Krt39 UTSW 11 99,412,062 (GRCm39) missense probably benign 0.19
R7036:Krt39 UTSW 11 99,412,062 (GRCm39) missense probably benign 0.19
R7424:Krt39 UTSW 11 99,408,917 (GRCm39) missense probably damaging 1.00
R7449:Krt39 UTSW 11 99,408,887 (GRCm39) missense probably benign 0.02
R7627:Krt39 UTSW 11 99,405,575 (GRCm39) missense possibly damaging 0.80
R7774:Krt39 UTSW 11 99,405,437 (GRCm39) splice site probably null
R7784:Krt39 UTSW 11 99,411,857 (GRCm39) nonsense probably null
R7827:Krt39 UTSW 11 99,409,901 (GRCm39) missense probably damaging 1.00
R8896:Krt39 UTSW 11 99,409,095 (GRCm39) missense probably damaging 0.99
R8961:Krt39 UTSW 11 99,409,931 (GRCm39) missense possibly damaging 0.52
R9245:Krt39 UTSW 11 99,407,450 (GRCm39) missense probably damaging 1.00
R9784:Krt39 UTSW 11 99,409,188 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACATAGCAGCACAGAAGGTTC -3'
(R):5'- GCTGTGCTCTACAAACTCCC -3'

Sequencing Primer
(F):5'- TAGCAGCACAGAAGGTTCTAGAATG -3'
(R):5'- CGATGCCCTCATTACTTGATAAG -3'
Posted On 2019-05-15