Incidental Mutation 'R7131:Dnah17'
ID 552687
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Name dynein, axonemal, heavy chain 17
Synonyms Dnahcl1, LOC382552, 2810003K23Rik, Dnahc17
MMRRC Submission 045216-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7131 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 117912549-118021460 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 117970484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2173 (D2173N)
Ref Sequence ENSEMBL: ENSMUSP00000101915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084803
AA Change: D2173N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: D2173N

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106308
AA Change: D2173N

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: D2173N

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: D2186N

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,396,637 (GRCm39) V365A probably damaging Het
Abca13 A G 11: 9,241,893 (GRCm39) N1252S probably benign Het
Abcc3 A T 11: 94,255,857 (GRCm39) F543I probably damaging Het
Adam15 T A 3: 89,254,287 (GRCm39) Q170L possibly damaging Het
Aldoc A G 11: 78,215,282 (GRCm39) I19V possibly damaging Het
Aoc1l1 T A 6: 48,953,306 (GRCm39) Y410* probably null Het
Atrip T C 9: 108,889,488 (GRCm39) I711M probably benign Het
Brwd1 A C 16: 95,867,698 (GRCm39) L149R probably damaging Het
Capn9 A T 8: 125,303,017 (GRCm39) D45V probably damaging Het
Card9 G A 2: 26,248,847 (GRCm39) R101C probably damaging Het
Ccdc87 A G 19: 4,891,785 (GRCm39) E759G probably damaging Het
Ccn1 T C 3: 145,354,536 (GRCm39) D125G probably damaging Het
Cep250 T C 2: 155,806,997 (GRCm39) M193T probably damaging Het
Cfap54 T C 10: 92,656,966 (GRCm39) K3029E probably benign Het
Chrna9 G A 5: 66,134,484 (GRCm39) G445D possibly damaging Het
Cluap1 C T 16: 3,758,639 (GRCm39) S367L probably benign Het
Col5a1 A G 2: 27,819,498 (GRCm39) D200G unknown Het
Crhr2 T C 6: 55,069,112 (GRCm39) N388D Het
Cyp2b23 A G 7: 26,380,838 (GRCm39) L129P probably benign Het
Dctd A G 8: 48,565,075 (GRCm39) S67G probably benign Het
Dhtkd1 C G 2: 5,908,881 (GRCm39) V738L probably benign Het
Dnah7c G T 1: 46,720,932 (GRCm39) A2819S probably benign Het
Dnai7 A T 6: 145,123,132 (GRCm39) L578Q probably null Het
Dot1l A G 10: 80,628,175 (GRCm39) H1071R unknown Het
Dync2h1 T A 9: 7,075,786 (GRCm39) D3027V probably damaging Het
Efl1 A G 7: 82,307,272 (GRCm39) Y56C probably damaging Het
Eif4e1b A T 13: 54,931,913 (GRCm39) R29W probably null Het
Evc2 A G 5: 37,567,602 (GRCm39) R860G probably damaging Het
Fbxl12 G A 9: 20,555,679 (GRCm39) probably benign Het
Fibp T A 19: 5,511,519 (GRCm39) I129N probably damaging Het
Folh1 G T 7: 86,375,320 (GRCm39) H555Q probably damaging Het
Gcnt4 A T 13: 97,083,027 (GRCm39) T108S probably damaging Het
H1f7 T A 15: 98,154,250 (GRCm39) K300* probably null Het
Hecw2 A T 1: 53,904,280 (GRCm39) V1156E probably damaging Het
Herc3 C G 6: 58,864,409 (GRCm39) A681G probably damaging Het
Igkv13-84 T A 6: 68,916,764 (GRCm39) C20* probably null Het
Iho1 A T 9: 108,294,619 (GRCm39) D98E probably benign Het
Iqca1l A G 5: 24,753,954 (GRCm39) V435A possibly damaging Het
Ivd C A 2: 118,700,255 (GRCm39) T94K probably damaging Het
Kank2 C T 9: 21,705,975 (GRCm39) A348T probably benign Het
Kcnma1 T C 14: 23,417,562 (GRCm39) Y889C probably damaging Het
Kif13b T C 14: 65,010,517 (GRCm39) V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,747,497 (GRCm39) probably benign Het
Kmt5b T A 19: 3,865,412 (GRCm39) D825E probably benign Het
Krt39 C T 11: 99,411,697 (GRCm39) A130T probably benign Het
Krtap4-9 C T 11: 99,676,283 (GRCm39) T68I unknown Het
Lmbr1l A T 15: 98,804,204 (GRCm39) V365E probably benign Het
Lonp1 C T 17: 56,924,814 (GRCm39) R531Q probably damaging Het
Mecom T A 3: 30,035,094 (GRCm39) H194L probably damaging Het
Mlx C T 11: 100,980,068 (GRCm39) H188Y probably damaging Het
Mrps10 T C 17: 47,685,940 (GRCm39) S77P probably damaging Het
Mst1 A G 9: 107,962,130 (GRCm39) E716G probably null Het
Mttp C T 3: 137,821,893 (GRCm39) V210I probably benign Het
Mug2 T C 6: 122,052,206 (GRCm39) V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 (GRCm39) M1T probably null Het
Neurog1 A T 13: 56,399,563 (GRCm39) N61K probably benign Het
Nlrp14 A G 7: 106,784,021 (GRCm39) D581G possibly damaging Het
Nlrp4a C A 7: 26,149,258 (GRCm39) N288K probably benign Het
Notch3 T A 17: 32,363,191 (GRCm39) H1264L probably benign Het
Or1e25 A T 11: 73,493,562 (GRCm39) D52V possibly damaging Het
Or1e34 A T 11: 73,778,780 (GRCm39) C139* probably null Het
Or3a1c A G 11: 74,046,606 (GRCm39) M209V probably benign Het
Patl2 A T 2: 121,952,263 (GRCm39) probably null Het
Pfkfb4 A G 9: 108,836,370 (GRCm39) T133A probably benign Het
Pla2g4f T C 2: 120,135,035 (GRCm39) E471G probably null Het
Postn T C 3: 54,270,056 (GRCm39) V45A probably damaging Het
Ppan T A 9: 20,802,450 (GRCm39) V257E possibly damaging Het
Ptcra C G 17: 47,074,522 (GRCm39) A7P probably damaging Het
Ptprd C T 4: 75,984,577 (GRCm39) R523H probably damaging Het
Pycr3 A T 15: 75,790,544 (GRCm39) I105N possibly damaging Het
Rfx1 C A 8: 84,821,708 (GRCm39) Q815K probably damaging Het
Rfx3 T A 19: 27,746,028 (GRCm39) K668* probably null Het
Ryr2 A T 13: 11,655,213 (GRCm39) D3661E possibly damaging Het
Ryr2 A G 13: 11,683,697 (GRCm39) probably null Het
Sec23ip T A 7: 128,381,364 (GRCm39) S974T probably damaging Het
Semp2l2a A T 8: 13,886,982 (GRCm39) W370R probably damaging Het
Setbp1 A G 18: 79,130,175 (GRCm39) F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,395,590 (GRCm39) probably benign Het
Sh3pxd2b A G 11: 32,372,072 (GRCm39) K413R probably damaging Het
Slc39a12 T C 2: 14,454,614 (GRCm39) V544A probably damaging Het
Slc6a7 T C 18: 61,135,274 (GRCm39) Y418C probably damaging Het
Snx19 T G 9: 30,339,189 (GRCm39) I109S probably damaging Het
Spart T C 3: 55,029,220 (GRCm39) probably null Het
Sptbn2 A T 19: 4,799,488 (GRCm39) Q2097L probably null Het
Syne1 T C 10: 5,178,221 (GRCm39) K4751R probably damaging Het
Tigit C A 16: 43,482,615 (GRCm39) G40C probably damaging Het
Tmem181a T A 17: 6,348,247 (GRCm39) I264K probably damaging Het
Tom1 T A 8: 75,783,877 (GRCm39) I287N possibly damaging Het
Top2a G A 11: 98,895,008 (GRCm39) P864L possibly damaging Het
Trmt44 A T 5: 35,728,410 (GRCm39) V290E probably damaging Het
Try4 T C 6: 41,281,337 (GRCm39) I93T probably benign Het
Usp24 T A 4: 106,239,500 (GRCm39) H1147Q possibly damaging Het
Uspl1 A T 5: 149,130,745 (GRCm39) R109S probably benign Het
Vav3 T A 3: 109,571,662 (GRCm39) F755I probably damaging Het
Vezt A T 10: 93,806,409 (GRCm39) Y667* probably null Het
Vmn1r231 T A 17: 21,110,140 (GRCm39) L258F possibly damaging Het
Zfp207 T C 11: 80,286,354 (GRCm39) M489T unknown Het
Zfp462 A G 4: 55,009,380 (GRCm39) T449A probably benign Het
Zfp956 C A 6: 47,932,781 (GRCm39) Q19K probably benign Het
Zkscan8 A T 13: 21,709,443 (GRCm39) W152R probably damaging Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 117,979,040 (GRCm39) missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 117,933,999 (GRCm39) missense probably damaging 0.97
IGL00764:Dnah17 APN 11 117,987,311 (GRCm39) missense probably damaging 0.99
IGL00795:Dnah17 APN 11 117,984,460 (GRCm39) missense probably benign 0.35
IGL00823:Dnah17 APN 11 117,937,987 (GRCm39) missense probably benign 0.22
IGL01145:Dnah17 APN 11 117,937,999 (GRCm39) missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 117,940,760 (GRCm39) missense probably damaging 1.00
IGL01454:Dnah17 APN 11 117,949,223 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118,010,394 (GRCm39) missense probably damaging 1.00
IGL01548:Dnah17 APN 11 117,989,438 (GRCm39) missense probably benign 0.21
IGL01557:Dnah17 APN 11 117,964,512 (GRCm39) missense probably damaging 0.98
IGL01632:Dnah17 APN 11 117,924,707 (GRCm39) missense probably damaging 1.00
IGL01636:Dnah17 APN 11 117,931,882 (GRCm39) missense probably benign 0.03
IGL01672:Dnah17 APN 11 117,932,986 (GRCm39) missense probably damaging 0.97
IGL01822:Dnah17 APN 11 117,972,819 (GRCm39) missense probably damaging 1.00
IGL01869:Dnah17 APN 11 117,943,502 (GRCm39) missense probably benign 0.09
IGL01916:Dnah17 APN 11 118,016,114 (GRCm39) missense probably benign 0.00
IGL02131:Dnah17 APN 11 117,963,734 (GRCm39) missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118,015,087 (GRCm39) missense probably benign 0.01
IGL02220:Dnah17 APN 11 117,963,793 (GRCm39) nonsense probably null
IGL02454:Dnah17 APN 11 117,971,593 (GRCm39) missense probably damaging 0.98
IGL02458:Dnah17 APN 11 117,927,176 (GRCm39) missense probably damaging 1.00
IGL02588:Dnah17 APN 11 117,916,479 (GRCm39) missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 117,964,374 (GRCm39) missense probably damaging 1.00
IGL02881:Dnah17 APN 11 117,932,944 (GRCm39) missense probably damaging 1.00
IGL02952:Dnah17 APN 11 117,979,094 (GRCm39) missense probably benign 0.03
IGL03382:Dnah17 APN 11 117,972,769 (GRCm39) missense probably damaging 1.00
IGL03389:Dnah17 APN 11 117,985,805 (GRCm39) missense probably damaging 1.00
ergos UTSW 11 117,931,984 (GRCm39) splice site probably benign
watt UTSW 11 117,971,592 (GRCm39) missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 117,989,408 (GRCm39) missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 117,950,918 (GRCm39) missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 117,965,260 (GRCm39) missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 117,949,132 (GRCm39) missense probably benign 0.01
R0157:Dnah17 UTSW 11 118,017,997 (GRCm39) missense probably benign
R0320:Dnah17 UTSW 11 117,943,500 (GRCm39) missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 117,989,365 (GRCm39) missense probably benign 0.10
R0382:Dnah17 UTSW 11 118,019,822 (GRCm39) missense probably damaging 1.00
R0383:Dnah17 UTSW 11 117,958,373 (GRCm39) missense probably benign
R0400:Dnah17 UTSW 11 117,972,904 (GRCm39) missense probably damaging 1.00
R0420:Dnah17 UTSW 11 117,930,765 (GRCm39) missense probably damaging 1.00
R0483:Dnah17 UTSW 11 117,937,950 (GRCm39) missense probably benign
R0533:Dnah17 UTSW 11 118,001,363 (GRCm39) missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 117,963,726 (GRCm39) missense probably damaging 1.00
R0564:Dnah17 UTSW 11 117,973,807 (GRCm39) missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118,012,297 (GRCm39) missense probably benign 0.00
R0608:Dnah17 UTSW 11 117,981,575 (GRCm39) nonsense probably null
R0614:Dnah17 UTSW 11 117,961,394 (GRCm39) splice site probably benign
R0632:Dnah17 UTSW 11 117,958,508 (GRCm39) splice site probably benign
R0831:Dnah17 UTSW 11 117,951,097 (GRCm39) missense probably damaging 0.99
R0838:Dnah17 UTSW 11 117,950,930 (GRCm39) missense probably damaging 1.00
R0879:Dnah17 UTSW 11 117,947,661 (GRCm39) splice site probably benign
R1061:Dnah17 UTSW 11 117,943,514 (GRCm39) missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 117,933,001 (GRCm39) missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118,017,963 (GRCm39) critical splice donor site probably null
R1297:Dnah17 UTSW 11 118,012,192 (GRCm39) splice site probably benign
R1332:Dnah17 UTSW 11 117,934,041 (GRCm39) missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 117,934,041 (GRCm39) missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118,016,432 (GRCm39) splice site probably benign
R1418:Dnah17 UTSW 11 117,964,849 (GRCm39) missense probably damaging 0.98
R1432:Dnah17 UTSW 11 117,914,153 (GRCm39) missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118,005,059 (GRCm39) missense probably damaging 1.00
R1500:Dnah17 UTSW 11 117,991,879 (GRCm39) missense probably benign
R1506:Dnah17 UTSW 11 118,016,213 (GRCm39) missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 117,985,841 (GRCm39) missense probably benign
R1567:Dnah17 UTSW 11 118,016,811 (GRCm39) missense probably damaging 1.00
R1597:Dnah17 UTSW 11 117,994,324 (GRCm39) splice site probably benign
R1665:Dnah17 UTSW 11 118,012,321 (GRCm39) splice site probably benign
R1703:Dnah17 UTSW 11 117,917,575 (GRCm39) missense probably damaging 1.00
R1716:Dnah17 UTSW 11 117,923,424 (GRCm39) missense probably benign 0.00
R1727:Dnah17 UTSW 11 117,987,362 (GRCm39) nonsense probably null
R1727:Dnah17 UTSW 11 117,961,315 (GRCm39) missense probably damaging 0.98
R1728:Dnah17 UTSW 11 117,960,345 (GRCm39) missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 117,960,345 (GRCm39) missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118,012,742 (GRCm39) missense probably damaging 0.97
R1869:Dnah17 UTSW 11 117,938,015 (GRCm39) nonsense probably null
R1886:Dnah17 UTSW 11 117,998,987 (GRCm39) missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 117,957,794 (GRCm39) missense probably benign 0.00
R1954:Dnah17 UTSW 11 117,915,557 (GRCm39) missense probably damaging 1.00
R1969:Dnah17 UTSW 11 117,995,361 (GRCm39) missense probably benign 0.00
R1971:Dnah17 UTSW 11 117,995,361 (GRCm39) missense probably benign 0.00
R1975:Dnah17 UTSW 11 117,987,362 (GRCm39) nonsense probably null
R1977:Dnah17 UTSW 11 118,003,417 (GRCm39) missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 117,958,357 (GRCm39) missense probably benign 0.00
R2115:Dnah17 UTSW 11 118,010,628 (GRCm39) missense probably benign 0.00
R2132:Dnah17 UTSW 11 117,924,573 (GRCm39) missense probably damaging 0.98
R2200:Dnah17 UTSW 11 117,993,235 (GRCm39) splice site probably benign
R2277:Dnah17 UTSW 11 117,987,387 (GRCm39) missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 117,987,387 (GRCm39) missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118,017,210 (GRCm39) critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118,016,800 (GRCm39) missense probably benign 0.10
R2497:Dnah17 UTSW 11 117,977,850 (GRCm39) splice site probably null
R2923:Dnah17 UTSW 11 117,984,373 (GRCm39) missense probably damaging 1.00
R3121:Dnah17 UTSW 11 117,931,912 (GRCm39) missense probably damaging 1.00
R3236:Dnah17 UTSW 11 117,985,680 (GRCm39) missense probably benign 0.08
R3237:Dnah17 UTSW 11 117,985,680 (GRCm39) missense probably benign 0.08
R3498:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3499:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3746:Dnah17 UTSW 11 117,973,742 (GRCm39) missense probably benign 0.00
R3749:Dnah17 UTSW 11 117,973,742 (GRCm39) missense probably benign 0.00
R3762:Dnah17 UTSW 11 117,995,352 (GRCm39) missense probably benign 0.00
R3826:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3828:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3829:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3877:Dnah17 UTSW 11 117,915,533 (GRCm39) missense probably damaging 1.00
R3899:Dnah17 UTSW 11 117,985,634 (GRCm39) missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 117,985,634 (GRCm39) missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3913:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3930:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3931:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3969:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3970:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R4056:Dnah17 UTSW 11 117,961,364 (GRCm39) missense probably benign 0.05
R4113:Dnah17 UTSW 11 118,003,420 (GRCm39) missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118,009,598 (GRCm39) missense probably damaging 1.00
R4324:Dnah17 UTSW 11 117,985,039 (GRCm39) missense probably benign 0.01
R4412:Dnah17 UTSW 11 117,964,509 (GRCm39) missense probably damaging 1.00
R4413:Dnah17 UTSW 11 117,915,994 (GRCm39) missense probably benign 0.00
R4422:Dnah17 UTSW 11 117,972,799 (GRCm39) missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 117,943,769 (GRCm39) missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 117,965,119 (GRCm39) missense probably benign 0.02
R4677:Dnah17 UTSW 11 118,010,640 (GRCm39) missense probably damaging 1.00
R4716:Dnah17 UTSW 11 117,964,474 (GRCm39) missense probably benign 0.02
R4832:Dnah17 UTSW 11 117,917,606 (GRCm39) missense probably damaging 1.00
R4868:Dnah17 UTSW 11 117,999,038 (GRCm39) missense probably benign 0.03
R4897:Dnah17 UTSW 11 117,969,419 (GRCm39) missense probably damaging 1.00
R4928:Dnah17 UTSW 11 117,918,259 (GRCm39) missense probably damaging 1.00
R4937:Dnah17 UTSW 11 117,932,980 (GRCm39) missense probably damaging 1.00
R4957:Dnah17 UTSW 11 117,965,124 (GRCm39) missense probably benign 0.44
R5008:Dnah17 UTSW 11 118,001,403 (GRCm39) missense probably benign 0.01
R5016:Dnah17 UTSW 11 117,971,592 (GRCm39) missense probably damaging 0.96
R5027:Dnah17 UTSW 11 117,993,365 (GRCm39) missense probably benign 0.01
R5133:Dnah17 UTSW 11 118,007,939 (GRCm39) missense probably benign 0.00
R5140:Dnah17 UTSW 11 117,977,771 (GRCm39) missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118,005,005 (GRCm39) missense probably damaging 0.99
R5151:Dnah17 UTSW 11 117,918,293 (GRCm39) missense probably damaging 1.00
R5153:Dnah17 UTSW 11 117,973,800 (GRCm39) nonsense probably null
R5192:Dnah17 UTSW 11 117,925,185 (GRCm39) missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118,018,109 (GRCm39) missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118,018,109 (GRCm39) missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118,003,340 (GRCm39) missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118,008,029 (GRCm39) intron probably benign
R5396:Dnah17 UTSW 11 118,018,108 (GRCm39) missense probably benign
R5418:Dnah17 UTSW 11 117,985,810 (GRCm39) missense probably benign 0.04
R5534:Dnah17 UTSW 11 117,943,596 (GRCm39) missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 117,964,486 (GRCm39) missense probably benign 0.03
R5594:Dnah17 UTSW 11 117,934,055 (GRCm39) splice site probably null
R5634:Dnah17 UTSW 11 117,943,752 (GRCm39) splice site probably null
R5696:Dnah17 UTSW 11 117,991,882 (GRCm39) missense probably benign 0.44
R5802:Dnah17 UTSW 11 117,927,272 (GRCm39) missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 117,925,193 (GRCm39) missense probably damaging 1.00
R5873:Dnah17 UTSW 11 117,947,723 (GRCm39) missense probably benign 0.01
R5898:Dnah17 UTSW 11 118,005,039 (GRCm39) missense probably benign 0.00
R5934:Dnah17 UTSW 11 117,931,928 (GRCm39) missense probably benign
R6030:Dnah17 UTSW 11 117,916,375 (GRCm39) missense probably benign 0.32
R6030:Dnah17 UTSW 11 117,916,375 (GRCm39) missense probably benign 0.32
R6038:Dnah17 UTSW 11 117,946,715 (GRCm39) missense probably benign 0.00
R6038:Dnah17 UTSW 11 117,946,715 (GRCm39) missense probably benign 0.00
R6113:Dnah17 UTSW 11 118,017,101 (GRCm39) missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118,010,397 (GRCm39) missense probably benign 0.00
R6137:Dnah17 UTSW 11 117,916,480 (GRCm39) missense probably damaging 1.00
R6173:Dnah17 UTSW 11 117,930,772 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,150 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,148 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,149 (GRCm39) nonsense probably null
R6260:Dnah17 UTSW 11 118,017,149 (GRCm39) nonsense probably null
R6260:Dnah17 UTSW 11 118,017,150 (GRCm39) missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118,017,148 (GRCm39) missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118,017,116 (GRCm39) missense probably damaging 0.99
R6298:Dnah17 UTSW 11 117,998,987 (GRCm39) missense probably benign 0.00
R6300:Dnah17 UTSW 11 117,925,136 (GRCm39) missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118,019,981 (GRCm39) missense probably benign 0.09
R6363:Dnah17 UTSW 11 118,001,331 (GRCm39) missense probably benign
R6381:Dnah17 UTSW 11 118,020,011 (GRCm39) missense probably benign 0.08
R6418:Dnah17 UTSW 11 118,020,023 (GRCm39) missense probably damaging 0.99
R6660:Dnah17 UTSW 11 117,991,014 (GRCm39) missense probably benign
R6803:Dnah17 UTSW 11 118,016,198 (GRCm39) missense probably benign 0.00
R6820:Dnah17 UTSW 11 117,959,826 (GRCm39) missense probably damaging 0.99
R6885:Dnah17 UTSW 11 117,981,598 (GRCm39) missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 117,932,310 (GRCm39) missense probably damaging 0.98
R6932:Dnah17 UTSW 11 117,950,905 (GRCm39) missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 117,957,258 (GRCm39) missense probably damaging 1.00
R7000:Dnah17 UTSW 11 117,916,528 (GRCm39) critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118,009,697 (GRCm39) missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 117,936,944 (GRCm39) missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118,016,212 (GRCm39) missense probably benign
R7143:Dnah17 UTSW 11 117,976,956 (GRCm39) missense probably damaging 1.00
R7146:Dnah17 UTSW 11 117,972,936 (GRCm39) missense probably damaging 0.98
R7147:Dnah17 UTSW 11 117,985,755 (GRCm39) missense probably benign 0.31
R7172:Dnah17 UTSW 11 117,931,957 (GRCm39) nonsense probably null
R7183:Dnah17 UTSW 11 118,020,014 (GRCm39) missense probably benign
R7297:Dnah17 UTSW 11 117,994,182 (GRCm39) missense probably damaging 0.98
R7297:Dnah17 UTSW 11 117,946,556 (GRCm39) critical splice donor site probably null
R7367:Dnah17 UTSW 11 118,006,022 (GRCm39) missense probably benign
R7398:Dnah17 UTSW 11 117,971,550 (GRCm39) missense probably damaging 0.96
R7426:Dnah17 UTSW 11 117,981,543 (GRCm39) missense probably null 0.79
R7524:Dnah17 UTSW 11 118,012,307 (GRCm39) missense probably benign 0.03
R7529:Dnah17 UTSW 11 117,940,692 (GRCm39) critical splice donor site probably null
R7615:Dnah17 UTSW 11 118,001,373 (GRCm39) nonsense probably null
R7681:Dnah17 UTSW 11 117,916,012 (GRCm39) missense probably damaging 1.00
R7702:Dnah17 UTSW 11 118,012,304 (GRCm39) missense possibly damaging 0.64
R7702:Dnah17 UTSW 11 117,916,466 (GRCm39) missense probably benign 0.00
R7713:Dnah17 UTSW 11 117,915,997 (GRCm39) missense probably benign 0.02
R7809:Dnah17 UTSW 11 117,995,462 (GRCm39) missense probably benign 0.09
R7842:Dnah17 UTSW 11 117,970,508 (GRCm39) critical splice acceptor site probably null
R7935:Dnah17 UTSW 11 118,018,048 (GRCm39) missense probably benign 0.20
R7951:Dnah17 UTSW 11 118,009,592 (GRCm39) missense possibly damaging 0.64
R8070:Dnah17 UTSW 11 117,915,497 (GRCm39) missense probably damaging 0.97
R8098:Dnah17 UTSW 11 117,941,193 (GRCm39) missense probably damaging 1.00
R8101:Dnah17 UTSW 11 118,016,744 (GRCm39) missense probably benign
R8177:Dnah17 UTSW 11 118,019,753 (GRCm39) missense possibly damaging 0.60
R8343:Dnah17 UTSW 11 118,005,021 (GRCm39) missense probably benign
R8350:Dnah17 UTSW 11 117,977,873 (GRCm39) missense probably damaging 0.98
R8393:Dnah17 UTSW 11 117,947,855 (GRCm39) missense probably damaging 1.00
R8401:Dnah17 UTSW 11 117,915,485 (GRCm39) missense probably damaging 0.96
R8418:Dnah17 UTSW 11 117,994,284 (GRCm39) missense probably benign 0.01
R8450:Dnah17 UTSW 11 117,977,873 (GRCm39) missense probably damaging 0.98
R8546:Dnah17 UTSW 11 118,015,101 (GRCm39) missense probably benign 0.00
R8697:Dnah17 UTSW 11 117,976,985 (GRCm39) missense possibly damaging 0.96
R8710:Dnah17 UTSW 11 117,932,973 (GRCm39) missense probably damaging 1.00
R8713:Dnah17 UTSW 11 117,979,028 (GRCm39) missense probably damaging 1.00
R8722:Dnah17 UTSW 11 117,961,283 (GRCm39) nonsense probably null
R8797:Dnah17 UTSW 11 117,992,201 (GRCm39) missense probably benign 0.00
R8953:Dnah17 UTSW 11 118,016,238 (GRCm39) splice site probably benign
R8965:Dnah17 UTSW 11 117,915,492 (GRCm39) missense probably damaging 1.00
R8976:Dnah17 UTSW 11 117,917,666 (GRCm39) missense probably damaging 1.00
R9090:Dnah17 UTSW 11 117,931,870 (GRCm39) missense probably damaging 1.00
R9128:Dnah17 UTSW 11 117,937,004 (GRCm39) missense possibly damaging 0.76
R9134:Dnah17 UTSW 11 117,978,972 (GRCm39) missense probably damaging 1.00
R9245:Dnah17 UTSW 11 118,016,503 (GRCm39) missense probably benign 0.02
R9251:Dnah17 UTSW 11 118,012,618 (GRCm39) missense probably benign 0.03
R9271:Dnah17 UTSW 11 117,931,870 (GRCm39) missense probably damaging 1.00
R9367:Dnah17 UTSW 11 118,012,212 (GRCm39) missense possibly damaging 0.93
R9367:Dnah17 UTSW 11 117,987,464 (GRCm39) missense possibly damaging 0.95
R9381:Dnah17 UTSW 11 117,914,219 (GRCm39) missense probably benign
R9405:Dnah17 UTSW 11 118,009,737 (GRCm39) missense probably benign
R9449:Dnah17 UTSW 11 117,987,452 (GRCm39) missense probably benign 0.07
R9517:Dnah17 UTSW 11 117,915,440 (GRCm39) missense possibly damaging 0.76
R9588:Dnah17 UTSW 11 118,012,783 (GRCm39) missense probably benign 0.00
R9629:Dnah17 UTSW 11 117,979,804 (GRCm39) missense probably damaging 1.00
R9654:Dnah17 UTSW 11 117,927,156 (GRCm39) critical splice donor site probably null
R9655:Dnah17 UTSW 11 117,971,649 (GRCm39) missense possibly damaging 0.94
R9662:Dnah17 UTSW 11 117,925,166 (GRCm39) missense probably damaging 0.97
R9686:Dnah17 UTSW 11 117,979,048 (GRCm39) missense possibly damaging 0.46
R9689:Dnah17 UTSW 11 117,963,731 (GRCm39) missense probably damaging 1.00
R9706:Dnah17 UTSW 11 118,017,026 (GRCm39) missense probably damaging 1.00
X0058:Dnah17 UTSW 11 117,973,751 (GRCm39) missense probably damaging 1.00
Z1176:Dnah17 UTSW 11 118,017,992 (GRCm39) missense probably benign 0.01
Z1177:Dnah17 UTSW 11 117,977,786 (GRCm39) missense probably damaging 1.00
Z1177:Dnah17 UTSW 11 117,969,389 (GRCm39) missense possibly damaging 0.91
Z1177:Dnah17 UTSW 11 118,017,968 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCATGACCTGTAAAGCTCTC -3'
(R):5'- CTTGAAGAGCCTCTGAAGGG -3'

Sequencing Primer
(F):5'- AAAGCTCTCTCATACTGTGGTG -3'
(R):5'- CCCCGATGTCCCTTTAAGG -3'
Posted On 2019-05-15