Mutagenetix > Incidental Mutation

Incidental Mutation 'R7131:Ryr2'

552689

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7131 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11553102-12106945 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 11668811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000021750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

PDB Structure

X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<

Predicted Effect

probably null
Transcript: ENSMUST00000021750

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000170156

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,548,956	V435A	possibly damaging	Het
Abca13	A	G	11: 9,291,893	N1252S	probably benign	Het
Abcc3	A	T	11: 94,365,031	F543I	probably damaging	Het
Adam15	T	A	3: 89,346,980	Q170L	possibly damaging	Het
AF366264	A	T	8: 13,836,982	W370R	probably damaging	Het
Aldoc	A	G	11: 78,324,456	I19V	possibly damaging	Het
Atrip	T	C	9: 109,060,420	I711M	probably benign	Het
Brwd1	A	C	16: 96,066,498	L149R	probably damaging	Het
Capn9	A	T	8: 124,576,278	D45V	probably damaging	Het
Card9	G	A	2: 26,358,835	R101C	probably damaging	Het
Casc1	A	T	6: 145,177,406	L578Q	probably null	Het
Ccdc36	A	T	9: 108,417,420	D98E	probably benign	Het
Ccdc87	A	G	19: 4,841,757	E759G	probably damaging	Het
Cep250	T	C	2: 155,965,077	M193T	probably damaging	Het
Cfap54	T	C	10: 92,821,104	K3029E	probably benign	Het
Chrna9	G	A	5: 65,977,141	G445D	possibly damaging	Het
Cluap1	C	T	16: 3,940,775	S367L	probably benign	Het
Col5a1	A	G	2: 27,929,486	D200G	unknown	Het
Crhr2	T	C	6: 55,092,127	N388D		Het
Cyp2b23	A	G	7: 26,681,413	L129P	probably benign	Het
Cyr61	T	C	3: 145,648,781	D125G	probably damaging	Het
Dctd	A	G	8: 48,112,040	S67G	probably benign	Het
Dhtkd1	C	G	2: 5,904,070	V738L	probably benign	Het
Dnah17	C	T	11: 118,079,658	D2173N	probably benign	Het
Dnah7c	G	T	1: 46,681,772	A2819S	probably benign	Het
Dot1l	A	G	10: 80,792,341	H1071R	unknown	Het
Doxl2	T	A	6: 48,976,372	Y410*	probably null	Het
Dync2h1	T	A	9: 7,075,786	D3027V	probably damaging	Het
Efl1	A	G	7: 82,658,064	Y56C	probably damaging	Het
Eif4e1b	A	T	13: 54,784,100	R29W	probably null	Het
Evc2	A	G	5: 37,410,258	R860G	probably damaging	Het
Fbxl12	G	A	9: 20,644,383		probably benign	Het
Fibp	T	A	19: 5,461,491	I129N	probably damaging	Het
Folh1	G	T	7: 86,726,112	H555Q	probably damaging	Het
Gcnt4	A	T	13: 96,946,519	T108S	probably damaging	Het
Gm436	A	G	4: 144,670,067	V365A	probably damaging	Het
H1fnt	T	A	15: 98,256,369	K300*	probably null	Het
Hecw2	A	T	1: 53,865,121	V1156E	probably damaging	Het
Herc3	C	G	6: 58,887,424	A681G	probably damaging	Het
Igkv13-84	T	A	6: 68,939,780	C20*	probably null	Het
Ivd	C	A	2: 118,869,774	T94K	probably damaging	Het
Kank2	C	T	9: 21,794,679	A348T	probably benign	Het
Kcnma1	T	C	14: 23,367,494	Y889C	probably damaging	Het
Kif13b	T	C	14: 64,773,068	V1272A	probably damaging	Het
Kmt2d	GCTGCTGCT	GCTGCTGCTCCTGCTGCT	15: 98,849,616		probably benign	Het
Kmt5b	T	A	19: 3,815,412	D825E	probably benign	Het
Krt39	C	T	11: 99,520,871	A130T	probably benign	Het
Krtap4-9	C	T	11: 99,785,457	T68I	unknown	Het
Lmbr1l	A	T	15: 98,906,323	V365E	probably benign	Het
Lonp1	C	T	17: 56,617,814	R531Q	probably damaging	Het
Mecom	T	A	3: 29,980,945	H194L	probably damaging	Het
Mlx	C	T	11: 101,089,242	H188Y	probably damaging	Het
Mrps10	T	C	17: 47,375,015	S77P	probably damaging	Het
Mst1	A	G	9: 108,084,931	E716G	probably null	Het
Mttp	C	T	3: 138,116,132	V210I	probably benign	Het
Mug2	T	C	6: 122,075,247	V988A	probably damaging	Het
Ndufb6	A	G	4: 40,279,336	M1T	probably null	Het
Neurog1	A	T	13: 56,251,750	N61K	probably benign	Het
Nlrp14	A	G	7: 107,184,814	D581G	possibly damaging	Het
Nlrp4a	C	A	7: 26,449,833	N288K	probably benign	Het
Notch3	T	A	17: 32,144,217	H1264L	probably benign	Het
Olfr384	A	T	11: 73,602,736	D52V	possibly damaging	Het
Olfr394	A	T	11: 73,887,954	C139*	probably null	Het
Olfr402	A	G	11: 74,155,780	M209V	probably benign	Het
Patl2	A	T	2: 122,121,782		probably null	Het
Pfkfb4	A	G	9: 109,007,302	T133A	probably benign	Het
Pla2g4f	T	C	2: 120,304,554	E471G	probably null	Het
Postn	T	C	3: 54,362,635	V45A	probably damaging	Het
Ppan	T	A	9: 20,891,154	V257E	possibly damaging	Het
Ptcra	C	G	17: 46,763,596	A7P	probably damaging	Het
Ptprd	C	T	4: 76,066,340	R523H	probably damaging	Het
Pycrl	A	T	15: 75,918,695	I105N	possibly damaging	Het
Rfx1	C	A	8: 84,095,079	Q815K	probably damaging	Het
Rfx3	T	A	19: 27,768,628	K668*	probably null	Het
Sec23ip	T	A	7: 128,779,640	S974T	probably damaging	Het
Setbp1	A	G	18: 79,086,960	F19S	probably benign	Het
Setd1a	AAGCAGCAGCAGCAGCAGCAG	AAGCAGCAGCAGCAGCAG	7: 127,796,418		probably benign	Het
Sh3pxd2b	A	G	11: 32,422,072	K413R	probably damaging	Het
Slc39a12	T	C	2: 14,449,803	V544A	probably damaging	Het
Slc6a7	T	C	18: 61,002,202	Y418C	probably damaging	Het
Snx19	T	G	9: 30,427,893	I109S	probably damaging	Het
Spg20	T	C	3: 55,121,799		probably null	Het
Sptbn2	A	T	19: 4,749,460	Q2097L	probably null	Het
Syne1	T	C	10: 5,228,221	K4751R	probably damaging	Het
Tigit	C	A	16: 43,662,252	G40C	probably damaging	Het
Tmem181a	T	A	17: 6,297,972	I264K	probably damaging	Het
Tom1	T	A	8: 75,057,249	I287N	possibly damaging	Het
Top2a	G	A	11: 99,004,182	P864L	possibly damaging	Het
Trmt44	A	T	5: 35,571,066	V290E	probably damaging	Het
Try4	T	C	6: 41,304,403	I93T	probably benign	Het
Usp24	T	A	4: 106,382,303	H1147Q	possibly damaging	Het
Uspl1	A	T	5: 149,193,935	R109S	probably benign	Het
Vav3	T	A	3: 109,664,346	F755I	probably damaging	Het
Vezt	A	T	10: 93,970,547	Y667*	probably null	Het
Vmn1r231	T	A	17: 20,889,878	L258F	possibly damaging	Het
Zfp207	T	C	11: 80,395,528	M489T	unknown	Het
Zfp462	A	G	4: 55,009,380	T449A	probably benign	Het
Zfp956	C	A	6: 47,955,847	Q19K	probably benign	Het
Zkscan8	A	T	13: 21,525,273	W152R	probably damaging	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11834092	splice site	probably benign
IGL00757:Ryr2	APN	13	11618604	splice site	probably null
IGL00838:Ryr2	APN	13	11568503	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11585478	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11735502	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11703544	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11638485	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11587239	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11556685	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11591352	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11742036	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11799837	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11851204	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11721790	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11721761	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11601758	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11591316	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11594968	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11692677	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11585480	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11601842	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11595425	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11554550	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11790363	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11790363	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11597112	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11747564	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11572257	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11792762	nonsense	probably null
IGL02086:Ryr2	APN	13	11735556	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11759759	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11737873	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11741869	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11730388	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11747658	splice site	probably benign
IGL02369:Ryr2	APN	13	11619496	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11722721	splice site	probably benign
IGL02400:Ryr2	APN	13	11605244	splice site	probably benign
IGL02423:Ryr2	APN	13	11745198	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11745674	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11705699	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11554511	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11605189	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11738320	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11655677	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11595190	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11707793	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11918319	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11591269	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11759835	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11684479	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11643902	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11635582	splice site	probably benign
IGL03152:Ryr2	APN	13	11853150	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11742023	nonsense	probably null
IGL03180:Ryr2	APN	13	11568563	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11724387	splice site	probably benign
IGL03390:Ryr2	APN	13	11772416	missense	probably benign
IGL03410:Ryr2	APN	13	11588147	missense	probably damaging	0.99
Arruda	UTSW	13	11643895	missense	probably damaging	1.00
Arruda2	UTSW	13	11879496	missense	probably damaging	1.00
Arruda3	UTSW	13	11555448	missense	possibly damaging	0.91
barricuda	UTSW	13	11595014	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
BB006:Ryr2	UTSW	13	11690295	nonsense	probably null
BB016:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11690295	nonsense	probably null
H8562:Ryr2	UTSW	13	11717141	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11665962	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11761306	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11707796	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11594755	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11555448	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11824379	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11665919	missense	probably benign
R0018:Ryr2	UTSW	13	11595223	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11595784	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11595784	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11669038	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11869116	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11869116	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11568475	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11709921	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11714548	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11676251	splice site	probably benign
R0226:Ryr2	UTSW	13	11772556	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11716977	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11668839	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11705684	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11869156	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11834095	splice site	probably benign
R0558:Ryr2	UTSW	13	11638443	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11799861	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11731669	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11635559	missense	probably null
R0601:Ryr2	UTSW	13	11705633	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11622952	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11724333	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11566885	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11554529	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11738126	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11554529	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11669969	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11945981	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11660113	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11759703	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11883043	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11687879	splice site	probably benign
R1400:Ryr2	UTSW	13	11595076	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11714503	splice site	probably benign
R1443:Ryr2	UTSW	13	11779266	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11738149	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11727022	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11601841	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11554592	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11554549	nonsense	probably null
R1551:Ryr2	UTSW	13	11785143	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11759677	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11794563	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11718482	nonsense	probably null
R1686:Ryr2	UTSW	13	11603779	splice site	probably benign
R1696:Ryr2	UTSW	13	11731657	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11587442	splice site	probably null
R1728:Ryr2	UTSW	13	11587422	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11790267	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11745176	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11745176	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11700371	nonsense	probably null
R1801:Ryr2	UTSW	13	11595281	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11560586	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11587316	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11769878	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11731700	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11662075	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11738356	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11658958	nonsense	probably null
R1897:Ryr2	UTSW	13	11750932	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11591336	missense	probably benign
R1909:Ryr2	UTSW	13	11700349	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11556698	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11668962	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11731723	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11681080	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11585402	splice site	probably null
R2018:Ryr2	UTSW	13	11851188	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11851188	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11595736	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11665878	splice site	probably null
R2088:Ryr2	UTSW	13	11662229	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11712195	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11560607	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11577873	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11705793	nonsense	probably null
R2207:Ryr2	UTSW	13	11810937	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11662260	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11738216	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11738242	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11591237	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11801848	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11759703	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11593093	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11593093	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11761349	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11761349	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11772580	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11588159	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11738209	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11772427	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11918414	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11692682	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11779267	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11587437	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11737873	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11750725	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11649812	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11605233	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11717066	nonsense	probably null
R4430:Ryr2	UTSW	13	11735527	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12106415	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11749509	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11750685	splice site	probably null
R4668:Ryr2	UTSW	13	11593117	missense	probably benign
R4677:Ryr2	UTSW	13	11706667	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11824369	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11595233	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11692646	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11716998	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11577909	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11577909	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11577909	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11737753	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11657047	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11708227	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11687932	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11708227	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11687932	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11717097	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11655698	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11668820	missense	probably damaging	0.99
R4850:Ryr2	UTSW	13	11745752	missense	probably damaging	1.00
R4880:Ryr2	UTSW	13	11752218	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11594986	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11594986	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11709963	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11945945	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11742011	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11785080	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11714611	missense	possibly damaging	0.49
R4964:Ryr2	UTSW	13	11833992	missense	probably benign	0.00
R4966:Ryr2	UTSW	13	11714611	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11833992	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11595306	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11643895	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11587254	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11635536	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11700354	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11712243	nonsense	probably null
R5135:Ryr2	UTSW	13	11662130	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11660289	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11752321	missense	probably benign
R5187:Ryr2	UTSW	13	11772452	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11638430	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11772437	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11690363	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11556658	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11655713	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11705656	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11705701	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11745601	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11687909	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11555448	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11595014	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11708202	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11601805	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11595582	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11759836	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11769962	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11603732	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11560574	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11584154	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11790332	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11687902	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11660122	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11726953	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11662238	nonsense	probably null
R5974:Ryr2	UTSW	13	11714511	splice site	probably null
R6104:Ryr2	UTSW	13	11799825	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11792689	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11669017	missense	probably benign
R6208:Ryr2	UTSW	13	11895220	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11834078	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11660107	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11879496	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11761396	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11662383	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11834007	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11668821	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11594723	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11710065	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11595643	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11594723	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11738462	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11686966	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11726930	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11829654	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11827559	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11745601	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11566948	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11801243	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11654380	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11712166	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11794605	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11824400	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11649776	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11669987	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11655713	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11640327	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11810908	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11801177	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11686978	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11759757	missense	probably benign
R7189:Ryr2	UTSW	13	11883123	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11665913	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11597146	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11738194	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11745631	missense	probably benign
R7365:Ryr2	UTSW	13	11640275	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11785111	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11735620	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11556748	splice site	probably null
R7425:Ryr2	UTSW	13	11705644	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11555463	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11752282	missense	probably benign
R7460:Ryr2	UTSW	13	11705710	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11594876	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11638431	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11737985	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11799825	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11560653	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11761327	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11761315	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11690333	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11730343	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11751011	missense	probably benign
R7797:Ryr2	UTSW	13	11801180	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11827607	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11706623	nonsense	probably null
R7872:Ryr2	UTSW	13	11595724	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11792748	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11690295	nonsense	probably null
R7952:Ryr2	UTSW	13	11646427	splice site	probably null
R8008:Ryr2	UTSW	13	11657094	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11588140	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11945995	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11603698	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11827553	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11595506	nonsense	probably null
R8351:Ryr2	UTSW	13	11799832	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11668935	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11684478	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11659008	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11577778	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11560593	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11687989	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11686947	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11668969	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11735623	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11558048	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11779266	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11785104	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11799882	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11595038	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11603732	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11594786	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11738103	nonsense	probably null
R9056:Ryr2	UTSW	13	11595931	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11601838	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11603855	intron	probably benign
R9116:Ryr2	UTSW	13	11572299	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11654406	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11885538	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11829674	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11829674	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11595886	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11883116	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11750968	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11883090	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11883090	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11706692	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11883116	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11681087	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11794573	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11772577	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11737794	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11556604	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11587215	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11745218	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11668962	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11722760	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11687049	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11594899	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11692713	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11869156	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11703501	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11598611	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11643803	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11794549	nonsense	probably null
Z1177:Ryr2	UTSW	13	11750873	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CCTGGGCTTCAACAGTAGAG -3'
(R):5'- GACAATGCTGCAGAGGATTTGG -3'

Sequencing Primer
(F):5'- AAATCCAGGACTGTATTCTGGGTCC -3'
(R):5'- TGCTGCAGAGGATTTGGAAAAGAC -3'

Posted On

2019-05-15