Incidental Mutation 'R7132:Kctd18'
ID552718
Institutional Source Beutler Lab
Gene Symbol Kctd18
Ensembl Gene ENSMUSG00000054770
Gene Namepotassium channel tetramerisation domain containing 18
Synonyms4932411A20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location57955101-58018956 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 57967578 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 38 (R38*)
Ref Sequence ENSEMBL: ENSMUSP00000110052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114410] [ENSMUST00000159826] [ENSMUST00000161608] [ENSMUST00000163061] [ENSMUST00000164963]
Predicted Effect probably null
Transcript: ENSMUST00000114410
AA Change: R38*
SMART Domains Protein: ENSMUSP00000110052
Gene: ENSMUSG00000054770
AA Change: R38*

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159826
AA Change: R38*
SMART Domains Protein: ENSMUSP00000125245
Gene: ENSMUSG00000054770
AA Change: R38*

DomainStartEndE-ValueType
SCOP:d1t1da_ 23 65 2e-11 SMART
Blast:BTB 23 107 2e-24 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000161608
AA Change: R38*
SMART Domains Protein: ENSMUSP00000125153
Gene: ENSMUSG00000054770
AA Change: R38*

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163061
AA Change: R38*
SMART Domains Protein: ENSMUSP00000124053
Gene: ENSMUSG00000054770
AA Change: R38*

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164963
AA Change: R38*
SMART Domains Protein: ENSMUSP00000130952
Gene: ENSMUSG00000054770
AA Change: R38*

DomainStartEndE-ValueType
SCOP:d1t1da_ 23 65 2e-11 SMART
Blast:BTB 23 107 7e-24 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Kctd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Kctd18 APN 1 57956738 missense probably damaging 1.00
IGL01153:Kctd18 APN 1 57965391 missense probably damaging 1.00
IGL02513:Kctd18 APN 1 57965400 missense probably damaging 1.00
P0043:Kctd18 UTSW 1 57967563 missense probably damaging 1.00
R1823:Kctd18 UTSW 1 57956365 missense probably benign 0.05
R1918:Kctd18 UTSW 1 57959220 missense probably damaging 1.00
R1969:Kctd18 UTSW 1 57967620 missense probably benign 0.03
R1971:Kctd18 UTSW 1 57967620 missense probably benign 0.03
R2247:Kctd18 UTSW 1 57967642 missense possibly damaging 0.58
R4849:Kctd18 UTSW 1 57961993 missense probably damaging 0.99
R4922:Kctd18 UTSW 1 57965548 intron probably benign
R5165:Kctd18 UTSW 1 57959236 missense probably damaging 1.00
R5377:Kctd18 UTSW 1 57963093 missense probably benign 0.43
R5747:Kctd18 UTSW 1 57962024 intron probably benign
R5782:Kctd18 UTSW 1 57959237 missense probably damaging 1.00
R7253:Kctd18 UTSW 1 57961956 nonsense probably null
R7272:Kctd18 UTSW 1 57956551 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTCCATACAGCCATAATGAGCTAAG -3'
(R):5'- ACCACGTGAAATAGAGTCTGTG -3'

Sequencing Primer
(F):5'- ACAGCCATAATGAGCTAAGTAATTAG -3'
(R):5'- CACGTGAAATAGAGTCTGTGTGATTG -3'
Posted On2019-05-15