Incidental Mutation 'R7132:Kdm5b'
ID552721
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Namelysine (K)-specific demethylase 5B
SynonymsJarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134560171-134635285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134599106 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 322 (D322G)
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
Predicted Effect probably damaging
Transcript: ENSMUST00000047714
AA Change: D322G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: D322G

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112198
AA Change: D322G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: D322G

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134608966 missense probably benign 0.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134617840 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGTCTAAGGTCATCCTCCAC -3'
(R):5'- CCAAGCCTTGTTTTGTTCATGG -3'

Sequencing Primer
(F):5'- CTAAGCGATTAAGAGGCTACCTGCTC -3'
(R):5'- TTATCGATGAATCTAAAACCCACAGG -3'
Posted On2019-05-15