Incidental Mutation 'R7132:Fubp1'
ID552734
Institutional Source Beutler Lab
Gene Symbol Fubp1
Ensembl Gene ENSMUSG00000028034
Gene Namefar upstream element (FUSE) binding protein 1
Synonyms9530027K12Rik, FBP, Fubp, Fubp4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location152210422-152236826 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 152232024 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046045] [ENSMUST00000106121] [ENSMUST00000166984] [ENSMUST00000196695] [ENSMUST00000196739] [ENSMUST00000199470] [ENSMUST00000199876] [ENSMUST00000200452] [ENSMUST00000200524]
Predicted Effect probably benign
Transcript: ENSMUST00000046045
SMART Domains Protein: ENSMUSP00000037120
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
coiled coil region 176 358 N/A INTRINSIC
coiled coil region 391 419 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 487 493 N/A INTRINSIC
IG 519 603 4.82e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106121
SMART Domains Protein: ENSMUSP00000101727
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 571 599 1.3e-7 PFAM
Pfam:DUF1897 600 624 1.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166984
SMART Domains Protein: ENSMUSP00000130145
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196695
SMART Domains Protein: ENSMUSP00000143729
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 7e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.2e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.3e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.1e-4 PFAM
Pfam:DUF1897 601 625 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196739
SMART Domains Protein: ENSMUSP00000143101
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 568 596 1e-7 PFAM
Pfam:DUF1897 597 629 4.7e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198405
Predicted Effect probably benign
Transcript: ENSMUST00000199470
SMART Domains Protein: ENSMUSP00000143133
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
internal_repeat_1 14 35 5.77e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 5.77e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
low complexity region 176 210 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
coiled coil region 321 349 N/A INTRINSIC
coiled coil region 372 423 N/A INTRINSIC
IG 449 533 2e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000199876
AA Change: V642E
SMART Domains Protein: ENSMUSP00000143618
Gene: ENSMUSG00000028034
AA Change: V642E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.5e-7 PFAM
Pfam:DUF1897 601 625 1.5e-9 PFAM
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199918
Predicted Effect probably null
Transcript: ENSMUST00000200056
Predicted Effect probably benign
Transcript: ENSMUST00000200452
SMART Domains Protein: ENSMUSP00000143019
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200524
SMART Domains Protein: ENSMUSP00000143354
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 6.9e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.1e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.2e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 571 599 1.5e-4 PFAM
Pfam:DUF1897 600 632 7e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single stranded DNA-binding protein that binds to multiple DNA elements, including the far upstream element (FUSE) located upstream of c-myc. Binding to FUSE occurs on the non-coding strand, and is important to the regulation of c-myc in undifferentiated cells. This protein contains three domains, an amphipathic helix N-terminal domain, a DNA-binding central domain, and a C-terminal transactivation domain that contains three tyrosine-rich motifs. The N-terminal domain is thought to repress the activity of the C-terminal domain. This protein is also thought to bind RNA, and contains 3'-5' helicase activity with in vitro activity on both DNA-DNA and RNA-RNA duplexes. Aberrant expression of this gene has been found in malignant tissues, and this gene is important to neural system and lung development. Binding of this protein to viral RNA is thought to play a role in several viral diseases, including hepatitis C and hand, foot and mouth disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit pre- and perinatal lethality, cerebral hyperplasia, pale liver, hypoplastic lungs, spleen, thymus and bone marrow, cardiac hypertrophy, placental distress, small size, and anemia associated with variable, multilineage hematopoietic deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Fubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Fubp1 APN 3 152222234 missense probably damaging 0.97
IGL01328:Fubp1 APN 3 152220218 missense probably damaging 1.00
IGL01583:Fubp1 APN 3 152215624 missense possibly damaging 0.71
IGL02886:Fubp1 APN 3 152220755 missense possibly damaging 0.90
R0166:Fubp1 UTSW 3 152220204 nonsense probably null
R0268:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0344:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0759:Fubp1 UTSW 3 152210637 small insertion probably benign
R1159:Fubp1 UTSW 3 152215592 missense possibly damaging 0.93
R1194:Fubp1 UTSW 3 152231969 frame shift probably null
R1687:Fubp1 UTSW 3 152228201 unclassified probably benign
R1818:Fubp1 UTSW 3 152222169 missense probably damaging 1.00
R3880:Fubp1 UTSW 3 152220496 missense probably damaging 1.00
R4247:Fubp1 UTSW 3 152231936 missense possibly damaging 0.92
R4564:Fubp1 UTSW 3 152222936 nonsense probably null
R4776:Fubp1 UTSW 3 152222068 intron probably null
R4793:Fubp1 UTSW 3 152223329 missense possibly damaging 0.86
R4825:Fubp1 UTSW 3 152217890 splice site probably null
R5035:Fubp1 UTSW 3 152214851 missense probably benign 0.01
R5167:Fubp1 UTSW 3 152221352 missense possibly damaging 0.67
R5819:Fubp1 UTSW 3 152220553 missense probably damaging 1.00
R5892:Fubp1 UTSW 3 152218314 intron probably benign
R6254:Fubp1 UTSW 3 152232408 missense possibly damaging 0.66
R6814:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R6872:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R7612:Fubp1 UTSW 3 152218015 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCAGCAATAAAGTTCTCTGTTTTCC -3'
(R):5'- CATGATTTGCAAATCCCTGGGG -3'

Sequencing Primer
(F):5'- TCCTGAAGGTCAAGCAGTTC -3'
(R):5'- GGCATTACAAAAATAGCACTCAGATG -3'
Posted On2019-05-15