Incidental Mutation 'R7132:Asl'
ID552739
Institutional Source Beutler Lab
Gene Symbol Asl
Ensembl Gene ENSMUSG00000025533
Gene Nameargininosuccinate lyase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location130011258-130029247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130014702 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 211 (V211A)
Ref Sequence ENSEMBL: ENSMUSP00000124274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159619] [ENSMUST00000160129] [ENSMUST00000161094] [ENSMUST00000161640]
Predicted Effect
SMART Domains Protein: ENSMUSP00000125143
Gene: ENSMUSG00000025533
AA Change: V7A

DomainStartEndE-ValueType
Pfam:Lyase_1 1 108 3.7e-32 PFAM
Pfam:ASL_C2 171 238 1.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159619
AA Change: V211A

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123799
Gene: ENSMUSG00000025533
AA Change: V211A

DomainStartEndE-ValueType
Pfam:Lyase_1 11 305 2e-107 PFAM
Pfam:ASL_C2 367 436 1.6e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160129
AA Change: V211A

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124579
Gene: ENSMUSG00000025533
AA Change: V211A

DomainStartEndE-ValueType
Pfam:Lyase_1 11 305 1.8e-107 PFAM
Pfam:ASL_C2 368 435 1.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161094
AA Change: V211A

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124274
Gene: ENSMUSG00000025533
AA Change: V211A

DomainStartEndE-ValueType
Pfam:Lyase_1 11 305 2e-107 PFAM
Pfam:ASL_C2 367 436 1.6e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161640
AA Change: V211A

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124487
Gene: ENSMUSG00000025533
AA Change: V211A

DomainStartEndE-ValueType
Pfam:Lyase_1 11 262 7.2e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lyase 1 family. The encoded protein forms a cytosolic homotetramer and primarily catalyzes the reversible hydrolytic cleavage of argininosuccinate into arginine and fumarate, an essential step in the liver in detoxifying ammonia via the urea cycle. Mutations in this gene result in the autosomal recessive disorder argininosuccinic aciduria, or argininosuccinic acid lyase deficiency. A nontranscribed pseudogene is also located on the long arm of chromosome 22. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene fed well initially but then stopped feeding and became inactive before dying within 48 hours of birth. Arginine metabolism is disrupted leading to abnormal circulating amino acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Asl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Asl APN 5 130019804 missense probably damaging 0.96
IGL01881:Asl APN 5 130018538 unclassified probably benign
IGL02055:Asl APN 5 130013050 missense possibly damaging 0.85
IGL02087:Asl APN 5 130011601 nonsense probably null
IGL02309:Asl APN 5 130019781 missense probably damaging 1.00
IGL03343:Asl APN 5 130012067 missense probably damaging 1.00
R2939:Asl UTSW 5 130013404 missense probably damaging 1.00
R3081:Asl UTSW 5 130013404 missense probably damaging 1.00
R4005:Asl UTSW 5 130018832 critical splice donor site probably null
R4611:Asl UTSW 5 130018316 missense probably damaging 1.00
R4883:Asl UTSW 5 130013961 critical splice donor site probably null
R5278:Asl UTSW 5 130018831 critical splice donor site probably null
R6176:Asl UTSW 5 130018879 missense probably benign
R6198:Asl UTSW 5 130018916 missense probably benign 0.00
R6878:Asl UTSW 5 130024292 critical splice donor site probably null
R7146:Asl UTSW 5 130024449 unclassified probably benign
R7654:Asl UTSW 5 130018390 missense probably damaging 1.00
R8104:Asl UTSW 5 130011950 missense probably benign 0.31
R8410:Asl UTSW 5 130013510 missense possibly damaging 0.95
X0065:Asl UTSW 5 130013413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTCTCAATACCCATAGGCAAG -3'
(R):5'- TGTTCCCTGCATGGTGAAAC -3'

Sequencing Primer
(F):5'- TTGCACTGTGTAGCTGAGACCAC -3'
(R):5'- TGCATGTGATTGGTACCC -3'
Posted On2019-05-15