Incidental Mutation 'R7132:Gdf3'
ID552744
Institutional Source Beutler Lab
Gene Symbol Gdf3
Ensembl Gene ENSMUSG00000030117
Gene Namegrowth differentiation factor 3
SynonymsGdf-3, Vgr-2, ecat9, Vgr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location122605403-122610087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122606324 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 361 (D361E)
Ref Sequence ENSEMBL: ENSMUSP00000032211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032211] [ENSMUST00000112585] [ENSMUST00000112586] [ENSMUST00000147760] [ENSMUST00000203197] [ENSMUST00000203309]
Predicted Effect probably damaging
Transcript: ENSMUST00000032211
AA Change: D361E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032211
Gene: ENSMUSG00000030117
AA Change: D361E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 57 68 N/A INTRINSIC
Pfam:TGFb_propeptide 91 222 3.1e-7 PFAM
TGFB 266 366 6.86e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112585
SMART Domains Protein: ENSMUSP00000108204
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 15 181 3.6e-38 PFAM
Pfam:APOBEC_C 124 178 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112586
SMART Domains Protein: ENSMUSP00000108205
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 15 181 3.6e-38 PFAM
Pfam:APOBEC_C 124 178 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147760
Predicted Effect probably benign
Transcript: ENSMUST00000203197
Predicted Effect probably benign
Transcript: ENSMUST00000203309
SMART Domains Protein: ENSMUSP00000145417
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 121 1.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein is important in embryogenesis and likely plays a role ocular and skeletal development. Mice lacking a functional copy of this gene exhibit defects in early embryonic development resulting in embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit prenatal lethality and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Gdf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Gdf3 APN 6 122607126 missense probably damaging 1.00
R0396:Gdf3 UTSW 6 122607135 missense probably damaging 1.00
R1503:Gdf3 UTSW 6 122606337 missense probably damaging 1.00
R1553:Gdf3 UTSW 6 122609765 missense probably benign 0.02
R1762:Gdf3 UTSW 6 122606407 missense possibly damaging 0.71
R1824:Gdf3 UTSW 6 122609962 missense probably benign 0.33
R2696:Gdf3 UTSW 6 122606900 missense probably benign
R3963:Gdf3 UTSW 6 122606758 missense probably benign 0.00
R4113:Gdf3 UTSW 6 122607057 missense probably damaging 0.96
R5090:Gdf3 UTSW 6 122609754 missense probably benign 0.12
R5257:Gdf3 UTSW 6 122606386 missense probably damaging 1.00
R7615:Gdf3 UTSW 6 122606916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAATTAAGTAAGCTCACCAAGGGG -3'
(R):5'- GGCAAATTACTGTCATGGAGAGTG -3'

Sequencing Primer
(F):5'- CCAAGGGGTCCATAGTCATAC -3'
(R):5'- ATGGAGAGTGCCCCTTCTCAATG -3'
Posted On2019-05-15