Incidental Mutation 'R7132:Wbp11'
ID552745
Institutional Source Beutler Lab
Gene Symbol Wbp11
Ensembl Gene ENSMUSG00000030216
Gene NameWW domain binding protein 11
SynonymsNpwbp, SIPP1, 2510026P17Rik, D6Wsu113e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location136813654-136828233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136821542 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 170 (T170A)
Ref Sequence ENSEMBL: ENSMUSP00000112213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116514] [ENSMUST00000146348] [ENSMUST00000204272]
Predicted Effect probably benign
Transcript: ENSMUST00000116514
AA Change: T170A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112213
Gene: ENSMUSG00000030216
AA Change: T170A

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 1e-26 PFAM
low complexity region 191 209 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 344 367 N/A INTRINSIC
low complexity region 380 532 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146348
Predicted Effect probably benign
Transcript: ENSMUST00000204129
Predicted Effect probably benign
Transcript: ENSMUST00000204272
SMART Domains Protein: ENSMUSP00000145501
Gene: ENSMUSG00000030216

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 3.8e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which colocalizes with mRNA splicing factors and intermediate filament-containing perinuclear networks. This protein has 95% amino acid sequence identity to the mouse Wbp11 protein. It contains two proline-rich regions that bind to the WW domain of Npw38, a nuclear protein, and thus this protein is also called Npw38-binding protein NpwBP. The Npw38-NpwBP complex may function as a component of an mRNA factory in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Wbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Wbp11 APN 6 136821670 intron probably benign
IGL01408:Wbp11 APN 6 136814614 unclassified probably benign
R0639:Wbp11 UTSW 6 136816110 unclassified probably benign
R0685:Wbp11 UTSW 6 136814638 unclassified probably benign
R1264:Wbp11 UTSW 6 136814515 unclassified probably benign
R1987:Wbp11 UTSW 6 136820585 missense probably damaging 0.99
R2362:Wbp11 UTSW 6 136824332 missense probably damaging 1.00
R4646:Wbp11 UTSW 6 136821191 missense probably benign 0.10
R5682:Wbp11 UTSW 6 136814254 unclassified probably benign
R6045:Wbp11 UTSW 6 136821535 missense probably damaging 0.99
R6386:Wbp11 UTSW 6 136820525 missense probably benign 0.36
R6567:Wbp11 UTSW 6 136820539 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACACCATGTCCCAGGAGAG -3'
(R):5'- CCGAAGACTTTGGTCCTAGG -3'

Sequencing Primer
(F):5'- ATAGACACGGCCCGAGC -3'
(R):5'- GAGTTGAATGGCTCAGCACCATAC -3'
Posted On2019-05-15