Incidental Mutation 'R7132:Hmx2'
ID552749
Institutional Source Beutler Lab
Gene Symbol Hmx2
Ensembl Gene ENSMUSG00000050100
Gene NameH6 homeobox 2
SynonymsNkx5-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location131548773-131558014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131555916 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 253 (Y253C)
Ref Sequence ENSEMBL: ENSMUSP00000058205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051997] [ENSMUST00000084502] [ENSMUST00000124096] [ENSMUST00000183219] [ENSMUST00000207231] [ENSMUST00000207442] [ENSMUST00000207736] [ENSMUST00000208571]
Predicted Effect probably damaging
Transcript: ENSMUST00000051997
AA Change: Y253C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058205
Gene: ENSMUSG00000050100
AA Change: Y253C

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
HOX 149 211 1.31e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084502
SMART Domains Protein: ENSMUSP00000081547
Gene: ENSMUSG00000066979

DomainStartEndE-ValueType
WD40 2 43 5.69e-4 SMART
WD40 46 83 8.91e-1 SMART
WD40 88 124 5.1e-6 SMART
WD40 127 163 6.16e0 SMART
WD40 214 262 4.02e-4 SMART
WD40 265 302 1.97e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183219
AA Change: Y253C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138799
Gene: ENSMUSG00000050100
AA Change: Y253C

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
HOX 149 211 1.31e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207231
Predicted Effect probably benign
Transcript: ENSMUST00000207442
Predicted Effect probably benign
Transcript: ENSMUST00000207736
Predicted Effect probably benign
Transcript: ENSMUST00000208571
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the NKL homeobox family of transcription factors. Members in this family are of ancient origin and play an important role in organ development during embryogenesis. A related mouse protein plays a role in patterning of inner ear structures. In humans, variations in a region containing this gene have been associated with inner ear malformations, vestibular dysfunction, and hearing loss. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous disruption of this gene results behavioral abnormalities, such as hyperactivity, head tilting and circling, as well as abnormal vestibular morphogenesis, including severe dysgenesis of all three semicircular ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Hmx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Hmx2 APN 7 131555672 missense probably damaging 1.00
R1594:Hmx2 UTSW 7 131555502 missense probably benign 0.12
R2142:Hmx2 UTSW 7 131555859 missense probably damaging 0.99
R5979:Hmx2 UTSW 7 131554550 missense probably benign
R6697:Hmx2 UTSW 7 131555934 missense probably damaging 0.99
R7142:Hmx2 UTSW 7 131555736 missense probably damaging 0.99
R7426:Hmx2 UTSW 7 131554503 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCGACATGAAACGCTACCTGAG -3'
(R):5'- TAATATTTCTGGACACGCGCC -3'

Sequencing Primer
(F):5'- GTTAAGACTTGGTTCCAGAATCGCC -3'
(R):5'- AGCTCTGCGAAGGATCC -3'
Posted On2019-05-15