Incidental Mutation 'R7132:Cracr2b'
ID552750
Institutional Source Beutler Lab
Gene Symbol Cracr2b
Ensembl Gene ENSMUSG00000048200
Gene Namecalcium release activated channel regulator 2B
SynonymsEfcab4a, 6330520A15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141461094-141466613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141463738 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 84 (A84V)
Ref Sequence ENSEMBL: ENSMUSP00000055899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026583] [ENSMUST00000053670] [ENSMUST00000064151] [ENSMUST00000106000] [ENSMUST00000164016] [ENSMUST00000164924] [ENSMUST00000165194] [ENSMUST00000167491] [ENSMUST00000169665] [ENSMUST00000170879] [ENSMUST00000172215] [ENSMUST00000177840] [ENSMUST00000209892] [ENSMUST00000209988] [ENSMUST00000211071]
Predicted Effect probably benign
Transcript: ENSMUST00000026583
SMART Domains Protein: ENSMUSP00000026583
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053670
AA Change: A84V

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200
AA Change: A84V

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064151
SMART Domains Protein: ENSMUSP00000065116
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 179 1.8e-15 PFAM
low complexity region 409 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106000
SMART Domains Protein: ENSMUSP00000101622
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116247
Predicted Effect probably benign
Transcript: ENSMUST00000164016
SMART Domains Protein: ENSMUSP00000127149
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 179 3.3e-15 PFAM
low complexity region 243 287 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164924
SMART Domains Protein: ENSMUSP00000129632
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165194
Predicted Effect probably benign
Transcript: ENSMUST00000167491
AA Change: A84V

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127957
Gene: ENSMUSG00000048200
AA Change: A84V

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169665
SMART Domains Protein: ENSMUSP00000127983
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 249 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170879
AA Change: A84V

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129946
Gene: ENSMUSG00000048200
AA Change: A84V

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172215
AA Change: A84V

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132793
Gene: ENSMUSG00000048200
AA Change: A84V

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177840
SMART Domains Protein: ENSMUSP00000136331
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209892
Predicted Effect probably benign
Transcript: ENSMUST00000209988
Predicted Effect probably benign
Transcript: ENSMUST00000211071
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Cracr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Cracr2b APN 7 141465757 unclassified probably benign
IGL02092:Cracr2b APN 7 141464956 missense probably damaging 0.96
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0324:Cracr2b UTSW 7 141463746 missense probably damaging 1.00
R0453:Cracr2b UTSW 7 141464263 missense probably damaging 0.96
R0569:Cracr2b UTSW 7 141464935 unclassified probably benign
R1386:Cracr2b UTSW 7 141463568 missense probably damaging 1.00
R2061:Cracr2b UTSW 7 141465280 missense probably damaging 0.96
R3605:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R3607:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R4674:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R4675:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R5401:Cracr2b UTSW 7 141466223 makesense probably null
R6174:Cracr2b UTSW 7 141464836 missense probably damaging 1.00
R7127:Cracr2b UTSW 7 141465782 missense possibly damaging 0.73
R7303:Cracr2b UTSW 7 141463202 unclassified probably benign
R7448:Cracr2b UTSW 7 141464205 missense probably benign 0.26
R7965:Cracr2b UTSW 7 141464248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTACTATGCGACAAGGATGC -3'
(R):5'- AGCCCATCCACTGTAGAGTAG -3'

Sequencing Primer
(F):5'- AAGGGCTTCATCACTCGTCAG -3'
(R):5'- CCATCCACTGTAGAGTAGCTGTG -3'
Posted On2019-05-15