Incidental Mutation 'R7132:Syne1'
ID552756
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5243180 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 3956 (A3956V)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000215295
AA Change: A3956V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5333023 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7131:Syne1 UTSW 10 5228221 missense probably damaging 1.00
R7133:Syne1 UTSW 10 5231592 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7189:Syne1 UTSW 10 5424295 missense probably benign 0.03
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5424382 missense probably damaging 1.00
R7577:Syne1 UTSW 10 5124820 missense probably damaging 1.00
R7579:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R7594:Syne1 UTSW 10 5215190 critical splice donor site probably null
R7646:Syne1 UTSW 10 5172949 missense probably damaging 1.00
R7651:Syne1 UTSW 10 5205074 missense probably benign 0.38
R7651:Syne1 UTSW 10 5343416 missense probably damaging 1.00
R7669:Syne1 UTSW 10 5061531 missense probably damaging 1.00
R7672:Syne1 UTSW 10 5218527 missense probably benign 0.02
R7682:Syne1 UTSW 10 5162461 missense probably benign
R7702:Syne1 UTSW 10 5245835 missense probably damaging 1.00
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATCACTGCATGGACCAC -3'
(R):5'- CGTCCTATTTGTGCCTTACTGAAATAC -3'

Sequencing Primer
(F):5'- ATCACTGCATGGACCACTCTGG -3'
(R):5'- GTGCCTTACTGAAATACAAATGTGC -3'
Posted On2019-05-15