Mutagenetix > Incidental Mutations

Incidental Mutation 'R7132:Ints2'

552763

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7132 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 86217754 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 922 (N922K)

Ref Sequence

ENSEMBL: ENSMUSP00000018212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: N922K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: N922K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: N922K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: N922K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134828

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	C	T	10: 69,989,914	A1471V		Het
Ankrd12	C	A	17: 65,983,247	M1730I	probably benign	Het
Ap2a2	T	C	7: 141,619,565	Y462H	probably benign	Het
Ap5b1	T	A	19: 5,569,384	Y277*	probably null	Het
App	T	C	16: 85,056,482	D236G	unknown	Het
Arid2	A	T	15: 96,350,013	K102I	possibly damaging	Het
Asl	A	G	5: 130,014,702	V211A	possibly damaging	Het
Card6	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	15: 5,098,691		probably benign	Het
Cbx2	A	G	11: 119,023,121	S5G	probably benign	Het
Ccdc183	A	G	2: 25,616,530		probably null	Het
Cd72	T	C	4: 43,452,444	Q183R	possibly damaging	Het
Cdh26	T	A	2: 178,486,762	D702E	possibly damaging	Het
Cfap61	A	T	2: 146,109,950	N784I	probably damaging	Het
Cgrrf1	G	A	14: 46,853,864	V282M	probably damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Cobll1	T	G	2: 65,133,768	K170Q	probably damaging	Het
Copg2	A	T	6: 30,815,996	V468D	probably benign	Het
Cracr2b	C	T	7: 141,463,738	A84V	probably benign	Het
Cyp2f2	A	T	7: 27,132,568	D416V	probably benign	Het
Dcaf10	T	C	4: 45,342,391	F75S	probably benign	Het
Eml3	G	T	19: 8,941,028	A829S	probably benign	Het
Entpd3	A	G	9: 120,561,020	T402A	probably benign	Het
Fer1l4	A	T	2: 156,045,626	V550E	probably damaging	Het
Fgb	G	A	3: 83,046,746	R62*	probably null	Het
Fubp1	T	A	3: 152,232,024		probably null	Het
Gdf3	A	C	6: 122,606,324	D361E	probably damaging	Het
Gm6685	A	T	11: 28,339,330	I162N	probably damaging	Het
Hmx2	A	G	7: 131,555,916	Y253C	probably damaging	Het
Ipo7	C	T	7: 110,054,047	L984F	probably benign	Het
Itgae	A	T	11: 73,111,358	Y96F	possibly damaging	Het
Kalrn	A	G	16: 34,256,227	V697A	unknown	Het
Kctd18	G	A	1: 57,967,578	R38*	probably null	Het
Kdm5b	A	G	1: 134,599,106	D322G	probably damaging	Het
Ldb3	A	G	14: 34,577,035	Y211H	probably benign	Het
Limch1	T	C	5: 66,953,685	F85S	probably damaging	Het
Lrrn4	A	T	2: 132,879,693	L68*	probably null	Het
Lrwd1	A	G	5: 136,123,275	V616A	possibly damaging	Het
Nars	A	G	18: 64,507,770		probably null	Het
Nradd	T	C	9: 110,622,261	D13G	probably benign	Het
Oacyl	A	T	18: 65,698,409	N39I	probably damaging	Het
Olfr1499	T	A	19: 13,815,422	Q56L	probably benign	Het
Onecut2	A	T	18: 64,340,912	H178L	possibly damaging	Het
Pcdhga4	A	C	18: 37,687,377	T660P	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pitpnm3	T	A	11: 72,051,276	I902F	possibly damaging	Het
Plod3	T	C	5: 136,995,117	L180S		Het
Prrc2c	A	T	1: 162,681,281	H2354Q	possibly damaging	Het
Pth2r	A	G	1: 65,322,066	E58G	probably benign	Het
Rev1	G	T	1: 38,071,449	D573E	possibly damaging	Het
Sec24a	A	T	11: 51,715,136	L696*	probably null	Het
Serpinb3c	A	G	1: 107,276,951	S22P	probably damaging	Het
St18	A	T	1: 6,859,127	H81L		Het
Stard9	A	T	2: 120,679,378	K266*	probably null	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Syne1	G	A	10: 5,243,180	A3956V	probably damaging	Het
Tcp10a	C	T	17: 7,344,952	T381I	probably benign	Het
Tecpr2	T	A	12: 110,915,372	V125D	probably damaging	Het
Tmc2	T	C	2: 130,232,409	S341P	possibly damaging	Het
Tmem190	G	A	7: 4,784,225	V143I	probably benign	Het
Trap1	A	G	16: 4,055,829	Y288H	probably benign	Het
Trim39	T	C	17: 36,260,655	T404A	probably benign	Het
Ttn	T	A	2: 76,745,699	K24950I	probably damaging	Het
Ttn	G	T	2: 76,944,352	N2161K	unknown	Het
Unc13b	T	C	4: 43,215,757	S19P	probably benign	Het
Uqcrc1	T	A	9: 108,949,468	I471N	probably damaging	Het
Wbp11	T	C	6: 136,821,542	T170A	probably benign	Het
Wnk4	A	G	11: 101,261,200	I177V	probably benign	Het
Zfp455	C	A	13: 67,199,166	P51T	probably damaging	Het
Zfp946	T	C	17: 22,454,663	Y133H	probably benign	Het
Zfp955a	A	T	17: 33,241,615	Y514*	probably null	Het
Zzef1	T	C	11: 72,917,871		probably null	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7928:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7958:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATAAGGTCTGTCTCCAACATCC -3'
(R):5'- TTCATCATTGTGCGGCATGC -3'

Sequencing Primer
(F):5'- TGCCACACAGGTGTCCAATAATATG -3'
(R):5'- TAGGTGTCCCCCACTAATGG -3'

Posted On

2019-05-15