Incidental Mutation 'R7132:Ldb3'
ID552768
Institutional Source Beutler Lab
Gene Symbol Ldb3
Ensembl Gene ENSMUSG00000021798
Gene NameLIM domain binding 3
Synonymscypher, ZASP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34526603-34588682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34577035 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 211 (Y211H)
Ref Sequence ENSEMBL: ENSMUSP00000022327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022327] [ENSMUST00000022328] [ENSMUST00000022330] [ENSMUST00000064098] [ENSMUST00000090040] [ENSMUST00000227819] [ENSMUST00000228044]
PDB Structure
Solution structure of PDZ domain of mouse Cypher protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000022327
AA Change: Y211H

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798
AA Change: Y211H

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022328
AA Change: Y211H

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798
AA Change: Y211H

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022330
AA Change: Y211H

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022330
Gene: ENSMUSG00000021798
AA Change: Y211H

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064098
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090040
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227819
Predicted Effect probably benign
Transcript: ENSMUST00000228044
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in lethality within a few days after birth from muscle abnormalities. Mutant mice exhibit myopathy, dysphagia, heart vascular congestion, dilated heart ventricles, cyanosis, and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Ldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ldb3 APN 14 34544200 missense probably damaging 0.99
IGL01485:Ldb3 APN 14 34542562 missense probably damaging 1.00
IGL01983:Ldb3 APN 14 34577199 missense probably benign 0.00
R0323:Ldb3 UTSW 14 34544045 missense probably damaging 1.00
R0335:Ldb3 UTSW 14 34578651 missense possibly damaging 0.77
R0483:Ldb3 UTSW 14 34536584 missense probably damaging 1.00
R0920:Ldb3 UTSW 14 34567503 missense probably benign 0.05
R1524:Ldb3 UTSW 14 34555356 missense probably benign 0.01
R2161:Ldb3 UTSW 14 34567396 critical splice donor site probably null
R2246:Ldb3 UTSW 14 34529475 missense probably damaging 0.99
R2865:Ldb3 UTSW 14 34529503 missense probably damaging 1.00
R3113:Ldb3 UTSW 14 34529461 makesense probably null
R3765:Ldb3 UTSW 14 34578682 splice site probably null
R3870:Ldb3 UTSW 14 34567483 missense probably damaging 1.00
R4018:Ldb3 UTSW 14 34552171 splice site probably benign
R4797:Ldb3 UTSW 14 34555513 missense possibly damaging 0.95
R4963:Ldb3 UTSW 14 34566858 missense probably damaging 0.98
R5705:Ldb3 UTSW 14 34577029 missense probably null 0.01
R6401:Ldb3 UTSW 14 34577334 missense probably benign 0.33
R6549:Ldb3 UTSW 14 34541897 missense probably damaging 0.99
R6682:Ldb3 UTSW 14 34552264 missense possibly damaging 0.77
R6917:Ldb3 UTSW 14 34555364 missense probably null 0.03
R7327:Ldb3 UTSW 14 34571802 missense probably damaging 1.00
R7488:Ldb3 UTSW 14 34567445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCGGACTCAATGGGATC -3'
(R):5'- AGTTCGGGGACACCTTTAGC -3'

Sequencing Primer
(F):5'- ACTCAATGGGATCCCTGCTG -3'
(R):5'- GGGGACACCTTTAGCTCCTC -3'
Posted On2019-05-15