Incidental Mutation 'R7132:Eml3'
ID552786
Institutional Source Beutler Lab
Gene Symbol Eml3
Ensembl Gene ENSMUSG00000071647
Gene Nameechinoderm microtubule associated protein like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8929552-8941582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8941028 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 829 (A829S)
Ref Sequence ENSEMBL: ENSMUSP00000093960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096240] [ENSMUST00000096241] [ENSMUST00000224272] [ENSMUST00000224642]
Predicted Effect probably benign
Transcript: ENSMUST00000096240
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096241
AA Change: A829S

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647
AA Change: A829S

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224272
AA Change: A828S

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000224642
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Eml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Eml3 APN 19 8936398 nonsense probably null
IGL01398:Eml3 APN 19 8934234 splice site probably benign
IGL01904:Eml3 APN 19 8936766 splice site probably benign
IGL02557:Eml3 APN 19 8931381 unclassified probably benign
IGL02795:Eml3 APN 19 8933778 missense probably benign 0.43
IGL03160:Eml3 APN 19 8934955 missense probably benign 0.04
IGL03172:Eml3 APN 19 8939179 unclassified probably benign
IGL03376:Eml3 APN 19 8933790 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0599:Eml3 UTSW 19 8939063 missense probably benign 0.14
R0652:Eml3 UTSW 19 8933285 missense probably damaging 1.00
R0827:Eml3 UTSW 19 8938466 missense probably damaging 0.98
R0841:Eml3 UTSW 19 8937685 missense probably benign
R0880:Eml3 UTSW 19 8940915 missense possibly damaging 0.92
R0924:Eml3 UTSW 19 8933311 critical splice donor site probably null
R1127:Eml3 UTSW 19 8936308 missense probably damaging 0.99
R1156:Eml3 UTSW 19 8934130 missense probably damaging 1.00
R1160:Eml3 UTSW 19 8933250 missense probably benign 0.00
R1427:Eml3 UTSW 19 8933861 missense probably damaging 1.00
R1497:Eml3 UTSW 19 8936369 missense probably damaging 1.00
R1679:Eml3 UTSW 19 8936637 missense probably damaging 0.98
R1931:Eml3 UTSW 19 8937143 missense probably benign 0.43
R2119:Eml3 UTSW 19 8934354 critical splice donor site probably null
R4296:Eml3 UTSW 19 8931409 missense probably damaging 1.00
R5122:Eml3 UTSW 19 8937696 critical splice donor site probably null
R5288:Eml3 UTSW 19 8939274 missense probably damaging 1.00
R5467:Eml3 UTSW 19 8937582 nonsense probably null
R5836:Eml3 UTSW 19 8941295 missense possibly damaging 0.96
R5845:Eml3 UTSW 19 8939218 missense probably damaging 1.00
R5879:Eml3 UTSW 19 8935015 missense possibly damaging 0.77
R5881:Eml3 UTSW 19 8933443 missense probably damaging 1.00
R6011:Eml3 UTSW 19 8939107 missense probably damaging 1.00
R6247:Eml3 UTSW 19 8930949 missense probably benign
R6777:Eml3 UTSW 19 8936722 missense probably benign
R7169:Eml3 UTSW 19 8933464 missense probably damaging 1.00
X0025:Eml3 UTSW 19 8937439 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACCTGAAACACTGCAACTCTAGG -3'
(R):5'- CACTCGCCACTGAAAGATGC -3'

Sequencing Primer
(F):5'- AACTCTAGGTTGTGGTAGCAGCC -3'
(R):5'- CAACTGGTTGCAGCAATG -3'
Posted On2019-05-15