Incidental Mutation 'R7133:Exoc4'
ID552813
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Nameexocyst complex component 4
SynonymsSec8l1, Sec8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location33249085-33973979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33438473 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 427 (A427T)
Ref Sequence ENSEMBL: ENSMUSP00000051965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266] [ENSMUST00000090381] [ENSMUST00000115080]
Predicted Effect probably benign
Transcript: ENSMUST00000052266
AA Change: A427T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: A427T

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090381
AA Change: A427T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087859
Gene: ENSMUSG00000029763
AA Change: A427T

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 24 144 1.1e-36 PFAM
low complexity region 338 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115080
AA Change: A427T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110732
Gene: ENSMUSG00000029763
AA Change: A427T

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 24 144 7.4e-37 PFAM
low complexity region 338 346 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33918399 critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33296788 missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33971924 missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33305400 splice site probably benign
IGL01559:Exoc4 APN 6 33266076 missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33757959 splice site probably benign
IGL01926:Exoc4 APN 6 33862142 missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33580026 missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33910584 missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33249240 critical splice donor site probably null
IGL02668:Exoc4 APN 6 33921532 missense probably benign 0.00
slacker UTSW 6 33758098 missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33296922 splice site probably null
R0134:Exoc4 UTSW 6 33971946 missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33972063 missense probably benign 0.09
R1033:Exoc4 UTSW 6 33265987 missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33442016 missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33758050 missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33266091 missense probably damaging 0.96
R2078:Exoc4 UTSW 6 33910587 missense probably benign 0.06
R2114:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33758158 missense probably benign 0.00
R2133:Exoc4 UTSW 6 33910538 missense probably benign
R2308:Exoc4 UTSW 6 33918568 missense probably damaging 1.00
R3412:Exoc4 UTSW 6 33265975 missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33475997 missense probably benign
R3885:Exoc4 UTSW 6 33266131 critical splice donor site probably null
R4378:Exoc4 UTSW 6 33815687 missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33438405 missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33862204 missense probably benign 0.00
R4771:Exoc4 UTSW 6 33441949 critical splice acceptor site probably null
R4851:Exoc4 UTSW 6 33918408 missense probably damaging 0.96
R4921:Exoc4 UTSW 6 33910517 missense probably benign
R5358:Exoc4 UTSW 6 33265999 missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33918432 missense probably benign
R6014:Exoc4 UTSW 6 33475997 missense probably benign
R6132:Exoc4 UTSW 6 33758098 missense probably damaging 1.00
R6164:Exoc4 UTSW 6 33332283 missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33815753 missense probably damaging 1.00
R6915:Exoc4 UTSW 6 33921453 missense possibly damaging 0.81
R6973:Exoc4 UTSW 6 33580030 missense probably damaging 1.00
R7112:Exoc4 UTSW 6 33921488 missense probably damaging 1.00
R7129:Exoc4 UTSW 6 33971999 missense probably damaging 1.00
R7547:Exoc4 UTSW 6 33839121 missense possibly damaging 0.95
R7885:Exoc4 UTSW 6 33758066 missense probably benign 0.00
R7968:Exoc4 UTSW 6 33758066 missense probably benign 0.00
X0066:Exoc4 UTSW 6 33815690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTGTGAATTGCTAACAGGG -3'
(R):5'- TTCACTTCCTACAAATTGCTCTAGG -3'

Sequencing Primer
(F):5'- GGAAGTCTAGGATGACGTA -3'
(R):5'- GCTCTAGGCAGTTTCAGCTAG -3'
Posted On2019-05-15